We narrowed to 80,033 results for: Rest
-
Plasmid#254613PurposeExpresses mt-optoIDR with TWINKLE (1-170 aa) to optogenetically induce biomolecular condensates within mitochondrial matrix in living cells.DepositorAvailable SinceMay 1, 2026AvailabilityAcademic Institutions and Nonprofits only
-
pDD3248 pCS2-mtagBFP2-p2a-NES-arrb2a-(ENLYFQ/S)x3-SV40NLS-sfCherry3C(1-10)
Plasmid#251770PurposeBlue fluorescent protein-tagged TEVp substrate (three-peat motif) for fluorescent protein reconstitution assayDepositorInsertarrestin, beta 2a (arrb2a Zebrafish)
TagsNLS (SV40), sfCherry3C large fragment and mTagBFP…ExpressionMammalianPromoterCMV IE94Available SinceApril 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTYB1-GFP-MeCP2 (pc4741 )
Plasmid#249083PurposeBacteria expression plasmid of GFP-MeCP2DepositorAvailable SinceApril 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
hTRAK1(S200A, S201A, S719A, S919A)
Plasmid#225225PurposeExpresses MYC-tagged hTRAK1 (S200A, S201A, S719A, S919A)DepositorInserttrak1 (TRAK1 Human)
TagsMYCExpressionMammalianMutationS200A, S201A, S719A, S919A mutationsPromoterCMVAvailable SinceFeb. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
MYC-hTRAK1(S200A, S201A)
Plasmid#219572PurposeExpresses MYC-tagged hTRAK1 (S200A, S201A)DepositorInserttrak1 (TRAK1 Human)
TagsMYCExpressionMammalianMutationSerine 200 changed to alanine, serine 201 changed…PromoterCMVAvailable SinceFeb. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLVX-EF1_-EGFR- FCRL3-50aa-Chimera-puro
Plasmid#248150PurposeLentiviral vector encoding a chimeric protein composed of the transmembrane region of FCRL3 and its truncated cytoplasmic tail (aa 595-644; first 50 residues), fused to the extracellular domain of EGFR.DepositorAvailable SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLVX-EF1_-EGFR-FCRL3-93aa-Chimera-puro
Plasmid#248149PurposeLentiviral vector encoding a chimeric protein composed of the transmembrane region of FCRL3 and its truncated cytoplasmic tail (aa 595-687; first 93 residues), fused to the extracellular domain of EGFR.DepositorAvailable SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
RC00214-pcsb-35Sp-ccdB-mNG-OCSp-tdT
Plasmid#209019PurposeDual-fluorescence acceptor plasmid for one-step insertion of a 5' leader of interest between the CaMV35S promoter and mNeonGreen via BpiI. A tdTomato expression cassette serves as internal control.DepositorInsertsccdB
mNeonGreen
tdTomato
ExpressionPlantMutationcodon optimized for N. benthamianaPromoterCaMV35S and Octopine SynthaseAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-3UTR
Plasmid#202550PurposeReady for cloning and heterologous expression of genes in mammalian cells with protein export to cultivation mediaDepositorTypeEmpty backboneTagsATG initiation codon followed by an IGKV3 signal …ExpressionMammalianPromoterCMVAvailable SinceAug. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgTnr#1/Cre
Plasmid#193244PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Tnr geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pODN-H2BC11-TagBFP
Plasmid#183867PurposeRepair template for the C-terminal tagging of H2B histones with mTagBFP in human cells using CRISPR/Cas9.DepositorInsertH2BC11 homology arms with linker-mTagBFP (H2BC11 Human)
UseCRISPR; Donor templateTagslinker-mTagBFPExpressionMammalianMutationHomology arms contain point mutations to remove t…Available SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
PEA1-Nuclease
Plasmid#176528PurposeDelivers all prime editing nuclease components in a single plasmidDepositorInsertCbH-Cas9-RT, hU6-pegRNA (Bbs1 gate), hU6-sgRNA (Bbs1 gate)
UseCRISPRExpressionMammalianMutationGC to CA point mutation in SpCas9 to restore nucl…PromoterCbH for Cas9, hU6 for gRNAsAvailable SinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
ST*-GFP
Plasmid#163667PurposeExpresses partial length ST in mammalian cellsDepositorInsertpartial length ST6 beta-galactoside alpha-2,6-sialyltransferase 1 (first 113 amino acids) (ST6GAL1 Human)
TagsGFPExpressionMammalianMutationThis chimera contains the first 113 amino acids o…Available SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA s3
Plasmid#132395PurposeTargets AAVS1 intron 1, gRNA: GGGGCCACTAGGGACAGGAT, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3/ TO myc-cCE-bio (cCE-bio)
Plasmid#82473PurposeExpresses cytoplasmic restricted form of N-terminal myc tagged and C-terminal biotin tagged mRNA capping enzyme, inactive formDepositorInsertMyc-NES-mCE (Wt, NLS deletion)-TEV-Bio (Rngtt Synthetic, Mouse)
TagsTEV-Biotin and mycExpressionMammalianPromoterCMVAvailable SinceSept. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 I674C (NT475)
Plasmid#50875PurposeExpresses human NKCC1 I674C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and YFPExpressionMammalianMutationI674C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 L737C (NT523)
Plasmid#50891PurposeExpresses human NKCC1 L737C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and YFPExpressionMammalianMutationL737C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 N672C (NT474)
Plasmid#50873PurposeExpresses human NKCC1 N672C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and YFPExpressionMammalianMutationN672C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 P676C (NT443)
Plasmid#50877PurposeExpresses human NKCC1 P676C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and YFPExpressionMammalianMutationP676C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 N731C (NT505)
Plasmid#50885PurposeExpresses human NKCC1 N731C mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and YFPExpressionMammalianMutationN731C in hNKCC1 in NT17PromoterCMVAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only