We narrowed to 14,310 results for: eng
-
Plasmid#199670Purposeexpresses V5-LOV-Turbo-NES in mammalian cells, AAV vectorDepositorInsertLOV-Turbo
UseAAVTagsNES and V5PromoterCAGAvailable sinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-N1-eKR2
Plasmid#115337PurposeExpresses enhanced sodium pump for light-driven extrusion of sodium; activation with green light; codon-optimized for human/mouseDepositorInserteKR2
TagsEYFPExpressionMammalianMutationnonePromoterCMVAvailable sinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX330-GFP-SFPQ
Plasmid#97084PurposeEncodes an sgRNA that creates a DSB at the promoter of human SFPQ gene.DepositorInsertsgRNA GFP-SFPQ
UseCRISPRPromoterU6Available sinceJuly 31, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pmCherry-C1-p63RhoGEF
Plasmid#67896PurposeExpresses a fusion of mCherry with full-length p63RhoGEF in mammalian cellsDepositorInsertmCherry-p63RhoGEF
ExpressionMammalianPromoterCMVAvailable sinceJan. 12, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PX459v3
Plasmid#178799PurposeSpCas9 with 2A-Puro, and a golden gate cloning backbone for sgRNA. sgRNA scaffold seqeuence has been modified for increased sgRNA expression (v3).DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterCbh (Cas9-2A Puro) and U6 (gRNA)Available sinceAug. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EF1a-hMLH1dn-eGFP
Plasmid#191104PurposeLentiviral expression plasmid of hMLH1dn with P2A-eGFP reporterDepositorInserthMLH1dn
UseLentiviralExpressionMammalianPromoterEF-1aAvailable sinceMay 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgRNA(lib)-puro
Plasmid#119976PurposeLenti sgRNA cloning backbone with CMV-puro resistance marker. Contains BsmBI sites for insertion of spacer sequences.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable sinceMarch 11, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pXPR003-sgTP53-2
Plasmid#118020PurposeConstitutive expression of sgRNA targeting human TP53DepositorAvailable sinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pXPR003-sgTP53-4
Plasmid#118022PurposeConstitutive expression of sgRNA targeting human TP53DepositorAvailable sinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
1056 pSG5L HA PTEN 380-385E
Plasmid#11171DepositorAvailable sinceJan. 3, 2006AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AAV-hSyn-DIO-mCReP
Plasmid#167503PurposeConditional expression of the eIF2alpha phophatase, CReP (Ppp1r15b)DepositorAvailable sinceJune 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
CAG-AausFP1-Z1
Plasmid#135047PurposeAausFP1 - bright green fluorescent protein expression from A. australis under CAG promoter in minimal backbone plasmid.DepositorInsertAausFP1
UseSynthetic BiologyExpressionMammalianPromoterCAG PromoterAvailable sinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
px459-TDP-43 sgRNA1
Plasmid#133762PurposeExpresses Cas9 and human TDP-43 sgRNADepositorAvailable sinceDec. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLITMUS-rpoN-cI-J23106-geneIII
Plasmid#80843PurposePhagemid (encodes M13 gene III and lambda cIopt).DepositorInsertsM13 gene III
Lambda cI
ExpressionBacterialPromoterBBa_J23106 and rpoNAvailable sinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
GST-Cav FL (1-178)
Plasmid#22445DepositorInsertCaveolin1(1-178)
TagsGSTExpressionBacterialAvailable sinceDec. 8, 2009AvailabilityAcademic Institutions and Nonprofits onlyCited by -
996 pSG5L HA PTEN S380A
Plasmid#10755DepositorAvailable sinceSept. 27, 2005AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AAV-∆Hapln1
Plasmid#200778PurposeExpresses mouse HAPLN1 mutant lacking the lectican binding domain and fused with cysteine-free GFP (cfGFP) under synapsin promoterDepositorHas serviceAAV8InsertHyaluronan And Proteoglycan Link Protein 1 (Hapln1 Mouse)
UseAAVTagscfGFPMutationdeleted lectican binding domain (aminoacids 40-15…PromoterSynapsinAvailable sinceMay 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
CMV-YE1-BE3-FNLS-CMV-mCherry
Plasmid#154005PurposeExpress YE1-BE3-FNLSDepositorInsertYE1-BE3-FNLS
UseCRISPRTagsFLAGPromoterCMVAvailable sinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLITMUS-rpoN-cIopt-J23106-geneIII
Plasmid#80852PurposePhagemid (encodes M13 gene III and lambda cIopt).DepositorInsertsM13 gene III
Lambda cIopt
ExpressionBacterialPromoterBBa_J23106 and rpoNAvailable sinceDec. 19, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJZC25
Plasmid#62328PurposesgRNA + 1x MS2 with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 1x MS2 binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available sinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only