We narrowed to 5,008 results for: AAT
-
Plasmid#32465DepositorInsertR-GECO1.0
UseLab constructedTags6x His and Modified TorA MNNNDLFQASRRRFLAQLG[G to…ExpressionBacterialMutationSubstitutions relative to the mApple-derived anal…Available SinceSept. 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-Tet-Puro-shIAPEz_2
Plasmid#185017PurposeshRNA mediated knockdownDepositorInsertERV_IAPEz
UseLentiviralAvailable SinceJuly 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-Tet-Puro-shIAPEz_1
Plasmid#185016PurposeshRNA mediated knockdownDepositorInsertERV_IAPEz
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBtPIPLC His
Plasmid#173808PurposeExpression and purification of the mature form of Bacillus thuringiensis phosphaatidyl inositol specific phospholipase C (PI-PLC), UniProt ID P08954 from E. coli BL21 CodonPlus (DE3) RIL cellsDepositorInsertBacillus thuringiensis 1-phosphatidylinositol phosphodiesterase
Tags6XHisExpressionBacterialMutationnonePromoterT7Available SinceOct. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
tet_pLKO.1_puro_shLuc
Plasmid#136587PurposeExpresses an inducible short hairpin targeting firefly luciferase sequenceDepositorInsertshLuc
UseLentiviralExpressionMammalianAvailable SinceJune 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
px335-sgRNA-EF(Cas9n)-Dnmt3b-L
Plasmid#122334PurposeExpresses sgRNA targeting mouse Dnmt3b and Cas9 nickase in mammalian cellsDepositorInsertsgRNA for mouse Dnmt3b
ExpressionMammalianAvailable SinceJune 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
RRM1 E2.3 gRNA
Plasmid#90881Purpose3rd generation lentiviral gRNA plasmid targeting human RRM1DepositorInsertRRM1 (Guide Designation E2.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCFD5-U6-3-t-attP40
Plasmid#133561PurposegRNA vector for targeting near the attP40 locus, use with pHD-3XP3-dsRed-DattP-CRISPR-donor-attP40 based constructsDepositorInsertattP40 region guide RNAs
UseCRISPRExpressionInsectPromoterU6Available SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSMP-EZH2_3
Plasmid#36389DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCAG-memRFP-3xControlgRNA
Plasmid#224567PurposeUbiquitous expression plasmid, CAG promoter (CMV immediate early enhancer and chicken beta actin promoter), three Control gRNAs with ribozyme self-cleavage sites, and membrane RFP reporter.DepositorInsertmRFP1
UseCRISPRTagsMembrane localization signalMutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDF0584 huDisCas7-11 S1006-GGGS-D1221 U6-NT guide
Plasmid#186993PurposeAAV transgene plasmid for Cas7-11-S1006-GGGS-D1221, with U6 promoter-driven expression of non-targeting crRNA guideDepositorInsertcas7-11-s1006-gggs-d122, non-targeting crRNA guide
UseAAVMutations1006-gggs-d1221 deletionAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-RacFRET-U6ac-ctrl guides
Plasmid#168247Purpose"label active Rac; control for neutrophil-specific knockout"DepositorInsertRacFRET
UseZebrafish expressionPromoterLyzCAvailable SinceMarch 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330.sgNf1.4
Plasmid#92028PurposepX330 sgNf1.4 for Nf1 deletionDepositorInsertsgNf1.4
UseMouse TargetingExpressionMammalianAvailable SinceNov. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G3_Dual_sgRNA
Plasmid#173202PurposeCoselection for PE3 or HDR in human cells. Vector for tandem expression of ATP1A1 G3 sgRNA with a user-specified PE3 nick sgRNA from two independent U6 promoters. Cloning of oligos using BbsI sites.DepositorInsertATP1A1 G3 sgRNA + user-specified sgRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
PX458_AHR_1
Plasmid#101076PurposeEncodes gRNA for 3' target of human AHRDepositorInsertgRNA against AHR (AHR Human)
UseCRISPRAvailable SinceOct. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
MASTL B4.4 gRNA
Plasmid#90755Purpose3rd generation lentiviral gRNA plasmid targeting human MASTLDepositorInsertMASTL (Guide Designation B4.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003 DLAT-2
Plasmid#184485PurposeLentivirus gRNA targeting human DLAT geneDepositorInsertDLAT-2
UseLentiviralAvailable SinceJune 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330.Pten.b
Plasmid#66588PurposesgRNA for Pten deletionDepositorInsertPten deletion (Pten Mouse)
ExpressionMammalianAvailable SinceJuly 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHelper-T7IS1
Plasmid#140631PurposeExpresses ShCAST under the T7 promoter and an empty sgRNADepositorInsertShTnsB, ShTnsC, ShTniQ, ShCas12k, sgRNA targeting IS1 (Escherichia coli)
UseCRISPR; TransposonExpressionBacterialAvailable SinceJuly 16, 2020AvailabilityAcademic Institutions and Nonprofits only