We narrowed to 14,481 results for: cas9
-
Plasmid#234737PurposeAll-in-one CRISPR/Cas9 vector encodes high-fidelity eSpCas9 and a gRNA targeting Nrl, efficiently reprogramming rod precursors into cone-like cells in the mouse retina.DepositorAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pLV hU6-VEGFR2#3 sgRNA Nestin-dCas9-KRAB-T2a-GFP
Plasmid#196990PurposeDerived from pLV hU6-sgRNA Nestin-dCas9-KRAB-T2a-GFP with KDR sgRNADepositorInsertVEGFR2
UseCRISPR and LentiviralAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA1-dCas9-KRAB-TagBFP2 (identifier AAAA-0245)
Plasmid#202554PurposeSynaptotagmin-1 sgRNA1 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ -CACCGCGTGCCTCGCACCGGTCCGCGG) (Syt1 R. norvegius (gRNA))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRP[CRISPR]-EGFP/Puro-hCas9-U6>(long left)-U6>(long right)
Plasmid#216871PurposeThis plasmid contains hCas9 and two gRNAs that can excise the genomic area around the mouse mdx mutation in dystrophin's exon 23DepositorInsertCas9, gRNA Long.L, gRNA Long.R (Dmd Mouse)
UseCRISPRMutationmdx mutation in mouse dystrophinAvailable SinceJune 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJT256 Lenti pEF-dCas9-3XFLAG-N+F-T2A-tagBFP-P2A-Blast
Plasmid#187332PurposedCas9 effector fusion for manipulating transcriptionDepositorInsertdCas9-3XFLAG-N+F-T2A-tagBFP-P2A-Blast
UseCRISPR and LentiviralTags3XFLAGExpressionMammalianPromoterpEF1aAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJT257 Lenti pEF-dCas9-3XFLAG-Z+F-T2A-tagBFP-P2A-Blast
Plasmid#187333PurposedCas9 effector fusion for manipulating transcriptionDepositorInsertdCas9-3XFLAG-Z+F+N-T2A-tagBFP-P2A-Blast
UseCRISPR and LentiviralTags3XFLAGExpressionMammalianPromoterpEF1aAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJT255 Lenti pEF-dCas9-3XFLAG-N+Z-T2A-tagBFP-P2A-Blast
Plasmid#187331PurposedCas9 effector fusion for manipulating transcriptionDepositorInsertdCas9-3XFLAG-N+Z-T2A-tagBFP-P2A-Blast
UseCRISPR and LentiviralTags3XFLAGExpressionMammalianPromoterpEF1aAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-nSpCas9(D10A)-BPNLS(SV40)-3xFLAG-P2A-EGFP (HES24)
Plasmid#185492PurposeCMV and T7 promoter expression plasmid for human codon usage nSpCas9(D10A) with a C-terminal bi-partite NLS, 3x FLAG, and P2A-eGFPDepositorInserthuman codon usage nSpCas9(D10A)-BPNLS-P2A-eGFP
UseIn vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-eGFPExpressionMammalianMutationD10APromoterCMV and T7Available SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
LB001: pMAGIC (L3-L2) 3x HA epitope tag + polyA; hU6::Sp/xCas9 TRE#2 gRNA
Plasmid#131757PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; hU6-driven Sp/xCas9 TRE#2 gRNA for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA epitope fusion to dCas9 w/ TRE#2 gRNA expressionDepositorInsertTRE#2 Sp/xCas9 gRNA
UseSynthetic Biology; Pmagic gateway entry plasmidPromoterhU6Available SinceOct. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
LA901: pMAGIC (L3-L2) 3x HA epitope tag + polyA; hU6::Sp/xCas9 TRE#1 gRNA
Plasmid#131756PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; hU6-driven Sp/xCas9 TRE#1 gRNA for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA epitope fusion to dCas9 w/ TRE#1 gRNA expressionDepositorInsertTRE#1 Sp/xCas9 gRNA
UseSynthetic Biology; Pmagic gateway entry plasmidPromoterhU6Available SinceOct. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
JV201: pMAGIC (L3-L2) 3x HA epitope tag + polyA; hU6::SaCas9 TRE#1 gRNA
Plasmid#131755PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; hU6-driven SaCas9 TRE#1 gRNA for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA epitope fusion to dCas9 w/ TRE#1 gRNA expressionDepositorInsertTRE#1 SaCas9 gRNA
UseSynthetic Biology; Pmagic gateway entry plasmidPromoterhU6Available SinceOct. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
LB101: pMAGIC (L3-L2) 3x HA epitope tag + polyA; hU6::SaCas9 TRE#2 gRNA
Plasmid#131758PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; hU6-driven SaCas9 TRE#2 gRNA for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA epitope fusion to dCas9 w/ TRE#2 gRNA expressionDepositorInsertTRE#2 SaCas9 gRNA
UseSynthetic Biology; Pmagic gateway entry plasmidPromoterhU6Available SinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR C2CD4AB-enh3-guide4
Plasmid#125411PurposeCRISPR-mediated repression of human islet enhancer containing T2D-associated variant rs17205526 (C2CD4A/B GWAS locus)DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceJuly 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR ZBED3-TSS-guide4
Plasmid#125451PurposeCRISPR-mediated repression of ZBED3. KRAB domain and Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR ZBED3-TSS-guide3
Plasmid#125450PurposeCRISPR-mediated repression of ZBED3. KRAB domain and Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR ZBED3-TSS-guide2
Plasmid#125449PurposeCRISPR-mediated repression of ZBED3. KRAB domain and Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR ZBED3-TSS-guide1
Plasmid#125448PurposeCRISPR-mediated repression of ZBED3. KRAB domain and Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR VEGFA-TSS-guide4
Plasmid#125443PurposeCRISPR-mediated repression of VEGFA. KRAB domain and Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only