We narrowed to 26,286 results for: grna
-
Plasmid#121842PurposepMAGIC L3-L2 entry plasmid, contains 3xHA tag+polyA; empty hU6-driven xCas9(3.7) gRNA scaffold for 3-/4-component MultiSite Gateway Pro assembly. Allows C-term HA fusion to dCas9 w/ gRNA expressionDepositorTypeEmpty backboneUseGateway Cloning and Synthetic BiologyAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pORANGE CACNG8-GFP KI #2
Plasmid#131474PurposeEndogenous tagging of Tarpγ8: Intramolecular (amino acid position: A408)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA and GFP donor (Cacng8 Rat)
ExpressionMammalianPromoterU6 and CbhAvailable sinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Cplx2-GFP KI
Plasmid#131476PurposeEndogenous tagging of Complexin2: C-terminal (amino acid position: L128)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA and GFP donor (Cplx2 Rat)
ExpressionMammalianPromoterU6 and CbhAvailable sinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMT1-13X-gRNA1-2(AtUBI10)-MTAP-LUC
Plasmid#234370PurposeT-DNA vector for expression of the two protein components of the MoonTag system under the control of the Arabidopsis Ubi10 promoter; Luciferase under control of transactivated promoter by two gRNAsDepositorInsertsNbGP41-sfGFP-VP64-GB1
Luciferase
dCas9-13XGP41
gRNA 1-1 and gRNA 1-2
UseSynthetic BiologyTagsGB1, GP41, and sfGFPExpressionPlantPromoterArabidopsis U6, Arabidopsis Ubi10, and MTAP1 (syn…Available sinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT1-24X-gRNA1-2(AtUBI10)-MTAP-LUC
Plasmid#234372PurposeT-DNA vector for expression of the two protein components of the MoonTag system under the control of the Arabidopsis Ubi10 promoter; Luciferase under control of transactivated promoter by two gRNAsDepositorInsertsNbGP41-sfGFP-VP64-GB1
Luciferase
dCas9-24XGP41
gRNA 1-1 and gRNA 1-2
UseSynthetic BiologyTagsGB1, GP41, and sfGFPExpressionPlantPromoterArabidopsis U6, Arabidopsis Ubi10, and MTAP1 (syn…Available sinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459-CTNNB1-S45
Plasmid#164587PurposeExpresses a gRNA that overlaps the S45 codon of human CTNNB1DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCTNNB1 gRNA (CTNNB1 Human)
UseCRISPRExpressionMammalianPromoterU6Available sinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217342PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available sinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
Oct4-Cr1
Plasmid#66989PurposeExpresses gRNA that targets stop codon for OCT4DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA for Crispr targeting the OCT4 stop codon
ExpressionMammalianAvailable sinceJuly 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLV-U6-UL29-U3-UL8
Plasmid#166685PurposeTo express gRNA expression cassette simultaneously targeting two genes: UL8 and UL29 (non-EGFP version).DepositorAvailable sinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti-TargetBC-5xTAPE-1-pegRNA-InsertBC
Plasmid#183790PurposeA single construct out of the pool of plasmid for lineage recording experiment using DNA Ticker Tape.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsP2A-eGFP-TargetBC-5xTAPE-1
pegRNA-InsertBC
UseSynthetic BiologyMutationG>A in the gRNA scaffold- please see depositor…Available sinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
SIR4 gRNA HIS
Plasmid#182520PurposeExpression vector for gRNA directed against SIR4 ORF.DepositorInsertSIR4 gRNA (SIR4 Budding Yeast)
ExpressionYeastAvailable sinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
Human CRISPRi sgRNA library Dolcetto in backbone XPR_050, Set A
Pooled library#92385PurposeCrispriDepositorUseLentiviralAvailable sinceJuly 13, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
hETFDH CRISPR_1
Plasmid#232309PurposeHuman ETFDH Gene Knockout (gRNA 1)DepositorPublicationInsertETFDH-targeting gRNA (ETFDH Human)
UseLentiviralAvailable sinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
hETFDH CRISPR_2
Plasmid#232310PurposeHuman ETFDH Gene Knockout (gRNA 2)DepositorPublicationInsertETFDH-targeting gRNA (ETFDH Human)
UseLentiviralAvailable sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pROF441
Plasmid#155336PurposeBinary vector for expression of a gRNA targeting AtAP1 promoterDepositorInsertLB_PAtU6-26-gRNA(PAtAP1)-sgRNA_RB
UseCRISPR and Synthetic BiologyExpressionPlantAvailable sinceOct. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLH-stsgRNA2.1
Plasmid#64117PurposeVector for expression of St1 sgRNA2.1 in mammalian cellsDepositorInsertSt1 sgRNA2.1
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_BB_2A-GFP_MAPRE1-gRNA#1
Plasmid#107726PurposeKnock out of EB1 in human cells by CRISPR/Cas9DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertMAPRE1 gRNA #1 (targets Exon 1) (MAPRE1 Human)
ExpressionMammalianPromoterU6Available sinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Lenti-sgRNA(MS2)-puro-barcode
Plasmid#89493PurposeCloning backbone for sgRNA, also has a barcode that allows detection from scRNA-seqDepositorInsertsgRNA (with MS2 loop)
UseLentiviralPromoterU6Available sinceJune 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEF005-sgRNA-shuffle-in
Plasmid#104441PurposeProvide and shuffle a cassette of AtU6:sgRNA-transRNA into SM-destination vectors (pRW006 and pRW004) with golden gate cloning strategy. Work together with pEF004.DepositorInsertsgRNA-transRNA transcription by U6 promoter
UseCRISPRExpressionBacterial and PlantAvailable sinceJan. 10, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEF004-sgRNA-shuffle-in
Plasmid#104440PurposeProvide and shuffle a cassette of AtU6:sgRNA-transRNA into SM-destination vectors (pRW006 and pRW004) with golden gate cloning strategy. Work together with pEF005DepositorInsertsgRNA-transRNA transcription by U6 promoter
UseCRISPRExpressionBacterial and PlantPromoterU6 promoterAvailable sinceDec. 27, 2017AvailabilityAcademic Institutions and Nonprofits only