We narrowed to 10,954 results for: AGA
-
Plasmid#194460PurposeCAR featuring: GMCSF (sig. peptide); CD8A & CD8A (hinge & TM); CD28, 4-1BB & CD3ζ (signaling domains); anti-JAG1 from J1.F1 in VL-VH order and 218 linker (scFv). GFP-Zeo for selection and monitoring.DepositorInsertAnti-JAG1 CAR
UseLentiviralTagsExpressionMutationPromoterAvailable sinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On shYap1-4
Plasmid#193670PurposeTet inducible knockdown of Yap1DepositorInsertYap1 (Yap1 Mouse)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shYAP1-2
Plasmid#193693PurposeConstitutive lentiviral expression of YAP1 shRNADepositorInsertYAP1 (YAP1 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNotch2#1/Cre
Plasmid#193225PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Notch2 geneDepositorInsertsgNotch2#1 (Notch2 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgSpen#1/Cre
Plasmid#193239PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Spen geneDepositorInsertsgSpen#1 (Spen Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgPcdh15#1/Cre
Plasmid#193229PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Pcdh15 geneDepositorInsertsgPcdh15#1 (Pcdh15 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgSpen#2/Cre
Plasmid#193240PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Spen geneDepositorInsertsgSpen#2 (Spen Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgTnr#2/Cre
Plasmid#193245PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Tnr geneDepositorInsertsgTnr#2 (Tnr Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgTnr#1/Cre
Plasmid#193244PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Tnr geneDepositorInsertsgTnr#1 (Tnr Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgTsc1#1/Cre
Plasmid#193246PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Tsc1 geneDepositorInsertsgTsc1#1 (Tsc1 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgZfp536#2/Cre
Plasmid#193249PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Zfp536 geneDepositorInsertsgZfp536#2 (Zfp536 Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5-STABLE2-neo-RvCAHS3
Plasmid#192472PurposeStable expression of RvCAHS3 (fly codon optimized) in Drosophila cellsDepositorInsertCAHS3
UseTagsT2A-EGFP-T2A-neoRExpressionInsectMutationPromoterAc5 promoterAvailable sinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-GG-hUbC-EBPF2-gRNA-DSP
Plasmid#185549PurposeLentiviral backbone with EBFP2 reporter and gRNA targeting DSPDepositorInsertDSP gRNAs
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
KTK_219
Plasmid#180534PurposeEntry vector containing K.rhaeticus native promoter pCmcAX (bcs1) (200 bases upstream from gene start codon)DepositorInsertK.rhaeticus native promoter pCmcAX (bcs1) (200 bases upstream from gene start codon)
UseTagsExpressionBacterialMutationPromoterAvailable sinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
KTK_223
Plasmid#180538PurposeEntry vector containing K.rhaeticus native promoter pHxu (200 bases upstream from gene start codon)DepositorInsertK.rhaeticus native promoter pHxu (200 bases upstream from gene start codon)
UseTagsExpressionBacterialMutationPromoterAvailable sinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
ppil2.280.457.Y389H
Plasmid#137658PurposeExpresses N-terminal (His)6-Thrombin cleavage site fusion of human gene or portion of gene with point mutation in bacterial strains. pET based vector.DepositorInsertppil2 (PPIL2 Human)
UseTags(His)6-thrombinExpressionBacterialMutation280-457-Y389HPromoterAvailable sinceAug. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
ppil2.280.457.Y389W
Plasmid#137657PurposeExpresses N-terminal (His)6-Thrombin cleavage site fusion of human gene or portion of gene with point mutation in bacterial strains. pET based vector.DepositorInsertppil2 (PPIL2 Human)
UseTags(His)6-thrombinExpressionBacterialMutation280-457-Y389WPromoterAvailable sinceAug. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
KTK_226
Plasmid#180552PurposeEntry vector containing K.rhaeticus native promoter pRutB (200 bases upstream from gene start codon)DepositorInsertK.rhaeticus native promoter pRutB (200 bases upstream from gene start codon)
UseTagsExpressionBacterialMutationPromoterAvailable sinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRnf43#2/Cre
Plasmid#173614PurposeExpresses a Rnf43-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Rnf43 (Rnf43 Mouse)
UseCRISPR, Cre/Lox, and LentiviralTagsExpressionMutationPromoterAvailable sinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
TKIT NFL gRNA1 gRNA2
Plasmid#182681PurposeExpression of spCas9, gRNA targeting intron 3 and gRNA targeting 3'UTR of the mouse Nefl gene. Can be used for the tagging of endogenous NFL via Targeted Knock-In with Two guides (TKIT) approach.DepositorInserttwo Nefl-targeting gRNAs, one targets intron 3 and the other 3'UTR of the Nefl gene (Nefl Mouse)
UseCRISPRTagsExpressionMammalianMutationPromoterU6 and chicken beta-actin promoterAvailable sinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
KTK_218
Plasmid#180533PurposeEntry vector containing K.rhaeticus native promoter pTtaC (200 bases upstream from gene start codon)DepositorInsertK.rhaeticus native promoter pTtaC (200 bases upstream from gene start codon)
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
KTK_225
Plasmid#180539PurposeEntry vector containing K.rhaeticus native promoter pBlh (200 bases upstream from gene start codon)DepositorInsertK.rhaeticus native promoter pBlh (200 bases upstream from gene start codon)
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
KTK_221
Plasmid#180536PurposeEntry vector containing K.rhaeticus native promoter pKr0953 (200 bases upstream from gene start codon)DepositorInsertK.rhaeticus native promoter pKr0953 (200 bases upstream from gene start codon)
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
KTK_220
Plasmid#180535PurposeEntry vector containing K.rhaeticus native promoter pAacsAB4 (200 bases upstream from gene start codon)DepositorInsertK.rhaeticus native promoter pAacsAB4 (200 bases upstream from gene start codon)
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
KTK_222
Plasmid#180537PurposeEntry vector containing K.rhaeticus native promoter pCyd (200 bases upstream from gene start codon)DepositorInsertK.rhaeticus native promoter pCyd (200 bases upstream from gene start codon)
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459_GRHL1-exon8
Plasmid#177764PurposesgRNA for CRISPR/Cas9-mediated deletion of human GRHL1DepositorInsertGRHL1 (GRHL1 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-HaloSFPQY527A
Plasmid#166949PurposeLentiviral plasmid expressing Halo-tagged SFPQ Y527A protein from the EF1a promoterDepositorInsertSFPQ-Y527A (SFPQ Human)
UseLentiviralTagsHaloExpressionMutationSFPQ-Y527APromotereF1aAvailable sinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
UbC-Halo-SFPQY527A
Plasmid#166947PurposeLentiviral plasmid expressing Halo-tagged SFPQ Y527A protein from the UbC promoterDepositorInsertSFPQ-Y527A (SFPQ Human)
UseLentiviralTagsHaloExpressionMutationSFPQ-Y527APromoterUbCAvailable sinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only