We narrowed to 4,506 results for: Erf
-
Plasmid#119279Purposefor stabilizing ICE in the presence of rapI expressionDepositorInsertdcas9
ExpressionBacterialMutationD10A and H840AAvailable SinceJan. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
POLArIS_NbVim-cp10GFP
Plasmid#171020PurposeExpresses NbVim-cp10GFP#2 in mammalian cellsDepositorInsertanti-vimentin-nanobody VB6 (NbVim) tagged with circularly permutated superfolderGFP(cp10GFP)
Tagscp10GFPExpressionBacterial and MammalianPromoterCMV promoterAvailable SinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMOD_A0402
Plasmid#91009PurposeModule A, Promoter: AtUbi10, Gene: AtCas9_dead (D10A + H840A), Terminator: HSPDepositorInsertAtCas9_dead (D10A + H840A)
UseCRISPRMutationD10A, H840APromoterAtUbi10Available SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET28a-ybbR-HIS-Xyl-DocI
Plasmid#58711PurposeCharacteristic fingerprint molecule to perform single molecule force spectroscopy experiments; covalently immobilized via ybbr tagDepositorInsertXyl-DocI
TagsHIS, HRV 3C, and ybbRExpressionBacterialMutationchanged Threonin 120 to Cysteine in Xylanase Doma…PromoterT7Available SinceAug. 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJMP1171
Plasmid#119253Purposerfp "test" strainDepositorInsertdcas9
ExpressionBacterialMutationD10A and H840AAvailable SinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET28-sfGFP-DogTag Loop B
Plasmid#171780PurposeExpresses in bacterial cytoplasm superfolder GFP with DogTag and flanking linkers between Asp102 and Asp103DepositorInsertsfGFP-DogTag Loop B
TagsHis6ExpressionBacterialMutationDogTag and linkers inserted between residues Asp1…PromoterT7Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDN0606 (pDEST-DHFR F[3] N-term,HygR)
Plasmid#210488PurposepDEST vector to tag gene of interest with DHFR F[3] on the N-terminus to perform DHFR-PCA in S. cerevisiae.DepositorTypeEmpty backboneUseSynthetic Biology; Destination vector for gateway…ExpressionYeastPromoterADH1Available SinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKB11 (pDEST-DHFR F[1,2] C-term, NatR)
Plasmid#210485PurposepDEST vector to tag gene of interest with DHFR F[1,2] on the C-terminus to perform DHFR-PCA in S. cerevisiae.DepositorTypeEmpty backboneUseSynthetic Biology; Destination vector for gateway…ExpressionYeastPromoterADH1Available SinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDN0605 (pDEST-DHFR F[1,2] N-term, NatR)
Plasmid#210487PurposepDEST vector to tag gene of interest with DHFR F[1,2] on the N-terminus to perform DHFR-PCA in S. cerevisiae.DepositorTypeEmpty backboneUseSynthetic Biology; Destination vector for gateway…ExpressionYeastPromoterADH1Available SinceDec. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKB12 (pDEST-DHFR F[3] C-term, HygR)
Plasmid#210486PurposepDEST vector to tag gene of interest with DHFR F[3] on the C-terminus to perform DHFR-PCA in S. cerevisiae.DepositorTypeEmpty backboneUseSynthetic Biology; Destination vector for gateway…ExpressionYeastPromoterADH1Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
NAX_CAGGS_CAS9_m4_KanR neo
Plasmid#167869PurposePiggyBac compatible plasmid expressing dCas9DepositorInsertdCas9
UseCRISPRMutationD10A, D839A, H840A, N863AAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pQTEV-PRKRA
Plasmid#31571DepositorInsertprotein kinase, interferon-inducible double stranded RNA dependent activator (PRKRA Human)
TagsHis and TEVExpressionBacterialAvailable SinceMarch 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pX330-HA-dSpCas9
Plasmid#92112PurposeExpression plasmid for human codon-optimized dead/inactive SpCas9 (without U6-sgRNA coding sequence)DepositorInsertdead/inactive SpCas9
UseCRISPRTagsHA tag and NLSExpressionMammalianMutationD10A, H840APromoterCbhAvailable SinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
dCas9-NLS-gs10-cGR2176
Plasmid#188258PurposePlasmid ensures constitutive expression of the C-terminal fragment of split GR2 (aa 239-267), fused to the catalytically inactive Cas9 (dCas9) protein, a flexible GS linker and the SV40 NLS signal at the N-terminusDepositorInsertcGR2176
UseCRISPRExpressionMammalianAvailable SinceNov. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFLAG GLTP
Plasmid#170740PurposeThe plasmids contain inserts (ORFs) for expressing various members of the GlycoLipid Transfer Protein (GLTP) superfamily.DepositorAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJMP1161
Plasmid#119251Purposerfp "test" strainDepositorInsertdcas9
ExpressionBacterialMutationD10A and H840AAvailable SinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET28a-Hook3 aa 1-160-GCN4
Plasmid#74608PurposeExpresses artificially dimerized Hook domain of Hook3 in bacteria for purificationDepositorInserthuman Hook3 amino acids 1-160 (HOOK3 Human)
Tags6x His, GCN4, Strep II, and superfolder GFPExpressionBacterialAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
spa-GCaMP6s
Plasmid#67556Purposephotoactivatable fluorescent calcium reporterDepositorInsertspa-GCaMP6s
TagsHIS-tagExpressionMammalianMutationK65T, I83V, G87S, Y92D, V115H, K118V, S187R, Y196…Available SinceJuly 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMOD_A0801
Plasmid#91022PurposeModule A, Promoter: 35S, Gene: Csy4-P2A-AtCas9_dead (D10A + H840A), Terminator: HSPDepositorInsertCsy4-P2A-AtCas9_dead (D10A + H840A)
UseCRISPRMutationD10A, H840APromoter35SAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1
Plasmid#188963PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: atcggtcgcattgttttccactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only