We narrowed to 30,716 results for: grn
-
Plasmid#87399PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1309a
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-sgRNA_Dicer_3
Plasmid#68809Purposespecific sgRNA against mouse Dicer1 gene cloned in the pX330 backbone (Addgene Number 42230). Generation of Dicer1 knockout mESCs.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA mouse Dicer1
UseCRISPR and Mouse TargetingExpressionBacterial and MammalianAvailable sinceFeb. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-sgRNA_Dgcr8_1
Plasmid#73525PurposeExpresses a human codon-optimized SpCas9 and sgRNA targeting Dgcr8DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertDGCR8
UseCRISPRExpressionMammalianPromoterhU6Available sinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCfB3043(gRNA XI-1)
Plasmid#73285PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XI-1DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable sinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
USP19 sgRNA1
Plasmid#78585Purposedelete USP19 gene in human cellDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertUSP19 sgRNA1
UseCRISPRExpressionMammalianPromoterCBhAvailable sinceJune 29, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pGRNA2I_LacZB1
Plasmid#247076PurposeL-arabinose inducible crRNA of type I-E CRISPR cas (Escherichia coli K-12). encoding 105 nt spacer which targets Ecoli LacZ B1 siteDepositorInserttype I-E CRISPR cas crRNA
UseCRISPRExpressionBacterialAvailable sinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR_AtU6p_BsaI_gRNA
Plasmid#225987PurposeTo make Gateway entry clone of CRISPR guide RNA under AtU6pDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable sinceOct. 7, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
p104_gRNA_Sp_CD3e
Plasmid#213780PurposeExpresses CRISPRi gRNA for CD3e promoter and GFP. gRNA driven by mU6.DepositorInsertSp gRNA
UseCRISPR and LentiviralAvailable sinceMay 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSGKP_AcsgRNA
Plasmid#203807PurposepSGKP-based plasmid containing a J23119-driven sgRNA cassette, with replaceable spacer (BsaI-restriction sites). Kanamycin resistance.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertAcgRNA
UseCRISPRPromoterJ23119Available sinceAug. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCBLgRNA
Plasmid#199726PurposeGateway entry vector for single gRNA under OsU3 promoter.DepositorInsertsgRNA scaffold
ExpressionPlantAvailable sinceApril 27, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pegRNA_LMNA_CR-2-5
Plasmid#199275PurposepegRNA used to correct LMNA (c.1824C > T) mutationDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertLMNA 1824TtoC pegRNA
ExpressionMammalianAvailable sinceApril 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
Rosa26_gRNA
Plasmid#196138PurposegRNA targeting the Rosa26 locus in a thid generation Cas9 backbone with TagBFP2DepositorInsertRosa26 gRNA
UseCRISPR and LentiviralExpressionMammalianAvailable sinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_hMECP2_promoter_No3
Plasmid#194898PurposeLentiviral construct with mCherry and Puro cassettes to express sgRNA-3 targeting the promoter of human MECP2DepositorInsertsgRNA targeting human MECP2 promoter No.3
UseLentiviralExpressionMammalianPromoterU6Available sinceJan. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_hMECP2_promoter_No9
Plasmid#194903PurposeLentiviral construct with mCherry and Puro cassettes to express sgRNA-9 targeting the promoter of human MECP2.DepositorInsertsgRNA targeting human MECP2 promoter No.9
UseLentiviralExpressionMammalianPromoterU6Available sinceJan. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
E42_gRunx1_gRNA3_dTet_NGFR
Plasmid#189803PurposeRetroviral delivery of guide RNA against mouse Runx1DepositorInsertgRunx1_gRNA3 (Runx1 Mouse)
UseRetroviralAvailable sinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
gRNAy
Plasmid#168294PurposeExpresses gRNA targeting the yellow gene in DrosophilaDepositorInsertU6.3-gRNA[y]-scaffold
ExpressionInsectAvailable sinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMC0x_gRNA_Pos5_Ptet
Plasmid#179336PurposegRNA Position Vector 5, used to create multi gRNA NT-CRISPR plasmid with pST_119_LVL2 camDepositorInsertPtet gRNA with sfGFP dropout
UseCRISPRAvailable sinceMarch 21, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMC0x_gRNA_Pos4_Ptet
Plasmid#179335PurposegRNA Position Vector 4, used to create multi gRNA NT-CRISPR plasmid with pST_119_LVL2 camDepositorInsertPtet gRNA with sfGFP dropout
UseCRISPRAvailable sinceMarch 21, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMC0x_gRNA_Pos5b2_Ptet
Plasmid#179342PurposegRNA Position Vector 5b2, used to create multi gRNA NT-CRISPR plasmid with pST_119_LVL2 camDepositorInsertPtet gRNA with sfGFP dropout
UseCRISPRAvailable sinceMarch 21, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
EC2_1_dCas9_sgRNA
Plasmid#163710PurposeYeast low copy plasmid with dCas9 and sgRNA expression cassetteDepositorInsertdCas9
ExpressionYeastMutationPoint mutations D10A and H840APromoterScTEF1Available sinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only