We narrowed to 10,269 results for: EPO
-
Plasmid#124811PurposeVector for expression Cas9 with gRNA specific for rat IgG2a heavy chain locus. Use in combination with pHybr_r2a>Fab-srt-his plasmids to convert expression of hybridomas to Fab' fragments.DepositorInsertCas9 – gRNA_R2A_hinge
UseCRISPRTags3XFLAG and GFPExpressionBacterial and MammalianMutationR166H in PuroR (please see depositors comment bel…PromoterpUCAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
Ai161 (TIT2L-GFP-ICR-tTA2) targeting vector
Plasmid#114429PurposeTarget a Cre-dependent GFP cassette and Dre-dependent tTA2 cassette to the mouse TIGRE locusDepositorInsertGFP
UseCre/Lox and Mouse TargetingPromoterTRE2, CAGAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
A3Bi-ctd E255A -Cas9n-UGI-NLS
Plasmid#109429PurposeExpresses the C-terminal catalytically inactive mutant of human APOBEC3B containing an L1 intron fused to Cas9n, Uracil DNA Glycosylase Inhibitor, with a nuclear localization signal.DepositorInsertApolipoprotein mRNA Editing Enzyme, Catalytic Polypeptide-like 3B C-terminal Doman E255A Catalytic Mutant (APOBEC3B Human)
UseCRISPRExpressionMammalianMutationInsertion of an L1 intron into the coding sequenc…PromoterCMVAvailable SinceJuly 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-Archon1-KGC-GFP-ER2
Plasmid#115890PurposeAAV-mediated expression of Archon1-KGC-GFP-ER2 under the EF1α promoter (1.1kb short version). Using SV40 signal.DepositorInsertArchon1-KGC-GFP-ER2
UseAAVTagsER2, GFP, and KGCExpressionMammalianPromoterEF1a(1.1kb short version)Available SinceDec. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc [Archon1-KGC-GFP-ER2]
Plasmid#115893PurposeAAV-mediated expression of Archon1-KGC-GFP-ER2 under the Syn promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorHas ServiceAAV8InsertArchon1-KGC-EGFP-ER2
UseAAVTagsER2, GFP, and KGCExpressionMammalianPromoterSynAvailable SinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-FLEX-rc [Archon1-KGC-GFP-ER2]
Plasmid#115891PurposeAAV-mediated expression of Archon1-KGC-GFP-ER2 under the EF1α promoter (1.1kb short version), in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertArchon1-KGC-GFP-ER2
UseAAVTagsER2, GFP, and KGCExpressionMammalianPromoterEF1α promoter (1.1kb short version)Available SinceJuly 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMVtrunc msfGFPΔC10-Utr28-222
Plasmid#231558PurposeExpresses N- and C-terminally truncated Utrophin calponin homology domain fused to C-terminally truncated msfGFP for actin filament organization measurements using fluorescence polarization microscopyDepositorInsertUtrophin calponin homology domain (UTRN Human)
TagsmsfGFPExpressionMammalianPromoterCMVtruncAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB-TAC-OSKM
Plasmid#80481PurposepiggyBac transposon for dox-inducible expression of the OSKM polycistronic reprogramming cassette (with mCherry)DepositorUsePiggybac transposonExpressionMammalianPromotertetOAvailable SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ai139 (TIT2L-GFP-ICL-TPT) targeting vector
Plasmid#114426PurposeTarget a Cre-dependent GFP and a tdTomato-P2A-tTA2 expression cassette into the mouse TIGRE locusDepositorInsertGFP, tdTomato, tTA2,
UseCre/Lox and Mouse TargetingPromoterTRE2, CAGAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
Ai163 (TIT2L-GC6s-ICL-TPT) targeting vector
Plasmid#114430PurposeTarget a Cre-dependent GCaMP6s cassette and a tdTomato-P2A-tTA2 cassette to the mouse TIGRE locusDepositorInsertGCaMP6s, tdTomato, tTA2
UseCre/Lox and Mouse TargetingPromoterTRE2, CAGAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
Ai167 (TIT2L-ChrimsonR-tdT-ICL-tTA2) targeting vector
Plasmid#114431PurposeTarget a Cre-dependent ChrimsonR-tdTomato cassette and a tTA2 cassette into the mouse TIGRE locusDepositorInsertChrimsonR-tdTomato, tTA2
UseCre/Lox and Mouse TargetingPromoterTRE2, CAGAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
Ai170 (TIT2L-ASAP2s-Kv-ICL-tTA2) targeting vector
Plasmid#114435PurposeTarget a Cre-dependent voltage sensor ASAP2s cassette into the mouse TIGRE locusDepositorInsertASAP2s-Kv, tTA2
UseCre/Lox and Mouse TargetingTagsKv2.1 tagPromoterTRE2, CAGAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
PB-TAC-MKOS
Plasmid#80484PurposepiggyBac transposon for dox-inducible expression of the MKOS polycistronic reprogramming cassette (with mCherry)DepositorUsePiggybac transposonExpressionMammalianPromotertetOAvailable SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetO-OCT4-KLF4-cMYC
Plasmid#216175PurposeGenerate lentiviruses encoding for OCT4, KLF4 and c-MYC (polycistronic vector); used in conjunction with SOX vectors for pluripotency reprogrammingDepositorAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB-TAC-OKMS
Plasmid#80480PurposepiggyBac transposon for dox-inducible expression of the OKMS (Oct4, Klf4[10-483], c-Myc, Sox2) polycistronic reprogramming cassette (with mCherry)DepositorUsePiggybac transposonExpressionMammalianMutationKlf4 [10-483]PromotertetOAvailable SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
AIMTOR T757
Plasmid#140828PurposeAIMTOR T757 contains a cytoplasmic mTOR Activity Reporter derived from hu ULK1 protein boxed between BRET-compatible entities (Ypet and Nanoluciferase) to measure mTOR activity in living cellsDepositorInsertAIMTOR T757 (ULK1 Human)
TagsNES Nuclear export signalExpressionMammalianMutationThe insert comprises only a small sequence of hum…Available SinceJuly 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
PB-TAC-OK+9MS
Plasmid#80482PurposepiggyBac transposon for dox-inducible expression of the OK+9MS (Oct4, Klf4[1-483], c-Myc, Sox2) polycistronic reprogramming cassette (with mCherry)DepositorUsePiggybac transposonExpressionMammalianMutationKlf4 [1-483]PromotertetOAvailable SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only