We narrowed to 10,372 results for: epo
-
Plasmid#114433PurposeTarget a Cre-dependent GCaMP6s cassette and a tTA2 cassette into the mouse TIGRE locusDepositorInsertGCaMP6s, tTA2
UseCre/Lox and Mouse TargetingPromoterTRE2, CAGAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
Calb1-T2A-dgCre targeting vector
Plasmid#114438PurposeTarget dgCre into the endogenous mouse Calb1 locus at the stop codonDepositorInsertdgCre
UseMouse TargetingTagsDHFR domain and EGFPPromoternone; utilizes endogenous Calb1 promoter for expr…Available SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
Ai148 (TIT2L-GC6f-ICL-tTA2) targeting vector
Plasmid#114428PurposeTarget a Cre-dependent GCaMP6f expression and a tTA2 cassette into the mouse TIGRE locusDepositorInsertGCaMP6f
UseCre/Lox and Mouse TargetingPromoterTRE2, CAGAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
P530_SIX6-p2A-h2b-EGFP
Plasmid#239101PurposeHuman donor plasmid for integration of p2A-h2b-EGFP into the 3' end of SIX6. This includes the donor casette and a U6 driven guide sequence to be used with Cas9.DepositorInsertSIX6 (SIX6 Human)
UseDonor plasmidTagsp2A-h2b-EGFPExpressionMammalianPromoterEndogenous SIX6 promoterAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMVtrunc beta-actinh7TAA-msfGFPΔN7ΔC11-SSSSactin
Plasmid#231549PurposeMammalian expression of human β-actin fused intramolecularly to N- and C-terminally truncated monomeric sfGFP, for actin filament organization measurements using fluorescence polarizationDepositorAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMVtrunc msfGFPΔC10-beta-actin
Plasmid#231548PurposeMammalian expression of human beta actin fused to C-terminally truncated monomeric superfolder GFP, for actin filament organization measurements using fluorescence polarization microscopyDepositorAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
Ai140 (TIT2L-GFP-ICL-tTA2) targeting vector
Plasmid#114427PurposeTarget a Cre-dependent GFP and a tTA2 expression cassette into the mouse TIGRE locusDepositorInsertGFP, tTA2
UseCre/Lox and Mouse TargetingExpressionMammalianPromoterPGK, CAGAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
Ai133 (TITL-ssAPEX2tm) targeting vector
Plasmid#114432PurposeTarget a Cre-dependent electron microscopy tag ssAPEX2tm cassette into the mouse TIGRE locusDepositorInsertssAPEX2tm
UseCre/Lox and Mouse TargetingPromoterTREtightAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
Ai161 (TIT2L-GFP-ICR-tTA2) targeting vector
Plasmid#114429PurposeTarget a Cre-dependent GFP cassette and Dre-dependent tTA2 cassette to the mouse TIGRE locusDepositorInsertGFP
UseCre/Lox and Mouse TargetingPromoterTRE2, CAGAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
PX459-gR2A_Hinge
Plasmid#124811PurposeVector for expression Cas9 with gRNA specific for rat IgG2a heavy chain locus. Use in combination with pHybr_r2a>Fab-srt-his plasmids to convert expression of hybridomas to Fab' fragments.DepositorInsertCas9 – gRNA_R2A_hinge
UseCRISPRTags3XFLAG and GFPExpressionBacterial and MammalianMutationR166H in PuroR (please see depositors comment bel…PromoterpUCAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
A3Bi-ctd E255A -Cas9n-UGI-NLS
Plasmid#109429PurposeExpresses the C-terminal catalytically inactive mutant of human APOBEC3B containing an L1 intron fused to Cas9n, Uracil DNA Glycosylase Inhibitor, with a nuclear localization signal.DepositorInsertApolipoprotein mRNA Editing Enzyme, Catalytic Polypeptide-like 3B C-terminal Doman E255A Catalytic Mutant (APOBEC3B Human)
UseCRISPRExpressionMammalianMutationInsertion of an L1 intron into the coding sequenc…PromoterCMVAvailable SinceJuly 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-Archon1-KGC-GFP-ER2
Plasmid#115890PurposeAAV-mediated expression of Archon1-KGC-GFP-ER2 under the EF1α promoter (1.1kb short version). Using SV40 signal.DepositorInsertArchon1-KGC-GFP-ER2
UseAAVTagsER2, GFP, and KGCExpressionMammalianPromoterEF1a(1.1kb short version)Available SinceDec. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc [Archon1-KGC-GFP-ER2]
Plasmid#115893PurposeAAV-mediated expression of Archon1-KGC-GFP-ER2 under the Syn promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorHas ServiceAAV8InsertArchon1-KGC-EGFP-ER2
UseAAVTagsER2, GFP, and KGCExpressionMammalianPromoterSynAvailable SinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-FLEX-rc [Archon1-KGC-GFP-ER2]
Plasmid#115891PurposeAAV-mediated expression of Archon1-KGC-GFP-ER2 under the EF1α promoter (1.1kb short version), in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertArchon1-KGC-GFP-ER2
UseAAVTagsER2, GFP, and KGCExpressionMammalianPromoterEF1α promoter (1.1kb short version)Available SinceJuly 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMVtrunc msfGFPΔC10-Utr28-222
Plasmid#231558PurposeExpresses N- and C-terminally truncated Utrophin calponin homology domain fused to C-terminally truncated msfGFP for actin filament organization measurements using fluorescence polarization microscopyDepositorInsertUtrophin calponin homology domain (UTRN Human)
TagsmsfGFPExpressionMammalianPromoterCMVtruncAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB-TAC-OSKM
Plasmid#80481PurposepiggyBac transposon for dox-inducible expression of the OSKM polycistronic reprogramming cassette (with mCherry)DepositorUsePiggybac transposonExpressionMammalianPromotertetOAvailable SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ai139 (TIT2L-GFP-ICL-TPT) targeting vector
Plasmid#114426PurposeTarget a Cre-dependent GFP and a tdTomato-P2A-tTA2 expression cassette into the mouse TIGRE locusDepositorInsertGFP, tdTomato, tTA2,
UseCre/Lox and Mouse TargetingPromoterTRE2, CAGAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
Ai163 (TIT2L-GC6s-ICL-TPT) targeting vector
Plasmid#114430PurposeTarget a Cre-dependent GCaMP6s cassette and a tdTomato-P2A-tTA2 cassette to the mouse TIGRE locusDepositorInsertGCaMP6s, tdTomato, tTA2
UseCre/Lox and Mouse TargetingPromoterTRE2, CAGAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only