We narrowed to 6,027 results for: SUP
-
Plasmid#217753PurposeFluorescent reporter for ceramide (mammalian expression)DepositorInsertKinase suppressor of ras 1 CA3 domain (KSR1 Human)
TagsEGFPExpressionMammalianMutationCA3 domain aa 317-400 plus vector-based linker LE…PromoterCMVAvailable SinceJune 10, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSbi-pur-EGFP-KSR1-CA3 (N-KSR)
Plasmid#217769PurposeFluorescent reporter for glucosyl-ceramide (putative, mammalian expression)DepositorInsertKinase suppressor of ras 1 CA3 domain (KSR1 Human)
UseSleeping beauty transposase-compatible genome ins…TagsEGFPExpressionMammalianMutationCA3 domain aa 317-400PromoterEF-1alpha promoterAvailable SinceJune 10, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSN-A112C-GpA-G83I
Plasmid#191239PurposeExpresses nuclease A-H124L from Staphylococcus aureus, with an A112C mutation, fused through a flexible linker to the transmembrane domain of GpA-G83I and a His-tag, for fluorescent studies.DepositorInsertnuc (nuclease A), GYPA (GPA) (E(transmembrane)R)
Tagsnuclease A from S. aureus fused to the TM domain …ExpressionBacterialMutationChanged Alanine 112 to Cysteine in SN, and Glycin…PromoterT7 promoterAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HCMVgO-sfGFP (Merlin)
Plasmid#136452PurposeMammalian expression plasmid for HCMV glycoprotein O (Merlin strain) fused to superfolder GFPDepositorInsertglycoprotein O (UL74 Human betaherpesvirus 5)
TagsGly/Ser-rich linker (GGSGGSGSGG) (includes BamHI …ExpressionMammalianMutationCodon-optimized for human cell expression.PromoterCMVAvailable SinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBABE-hygro NM23 H1 Pro
Plasmid#11366DepositorInsertNM23 H1 (NME1 Human)
UseRetroviralExpressionMammalianMutationPro96 mutation to Ser (reduces GAP activity).Available SinceMarch 1, 2006AvailabilityAcademic Institutions and Nonprofits only -
pKG03572_pLentiX1-(TRE-mRuby2-bGH)-cHS4.core-EFS-rtTA-P2A-mGL-WPRE
Plasmid#252557PurposeInducible Tet all-in-one circuit with divergent syntax and intergenic cHS4 core insulator, lentiviral vectorDepositorInsertrtTA-P2A-mGreenLantern
UseLentiviralExpressionMammalianPromoterEFS (human elongation factor 1-alpha - short/intr…Available SinceApril 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
TV_LGR5-ires-mNeon-nls-p2a-dtr-wpre_pgk-puro
Plasmid#251173PurposeTargeting vector for C-terminal knockin at LGR5 locus to enable reporting of expression by mNeonGreen and depletion of positive cells with DTRDepositorInsertires-mNeon-nls-p2a-dtr-wpre_pgk-puro flanked by homology arms for C-terminal targeting of human LGR5 (LGR5 Human)
UseCRISPRTagsires-mNeon-nls-p2a-dtrAvailable SinceFeb. 20, 2026AvailabilityAcademic Institutions and Nonprofits only -
pB-TR-hSOD1
Plasmid#232478PurposeTetracycline inducible PiggyBac vector expressing human SOD1gene including flag-tag (DYKDDDDK) on the 3' endDepositorInsertHomo sapiens superoxide dismutase 1 (SOD1 Human)
UseTransposon systemTagsDYKDDDDK (FLAG-tag)ExpressionMammalianPromoterCMV-TetOAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-PIK3CA H1047R-WPRE-UbC-Emerald
Plasmid#203798PurposeLentiviral vector expressing human PIK3CA H1047R under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorAvailable SinceJuly 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSMART-2,3-BDO1
Plasmid#65816PurposeNADH Dependent 2,3-BDO Production Construct, Low Phosphate Dependent E. coli ExpressionDepositorInsertsbudA: α-acetolactate decarboxylase
budB: acetolactate synthase
budC: acetoin reductase
ExpressionBacterialPromoterwaaHp from E. coli as part of operon with budA an…Available SinceJuly 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pASUS17R
Plasmid#1205DepositorAvailable SinceAug. 19, 2005AvailabilityAcademic Institutions and Nonprofits only -
pRS426-TUB1-internal6xHis - human TUBA1a Cterminal tail
Plasmid#60392PurposeExpression of chimeric yeast alpha tubulin (TUB1) - internal 6xHis with human alpha tubulin Cterminal tail (TUBA1a) using a GAL promoterDepositorInsertTUB1 (TUB1 Budding Yeast, Synthetic)
ExpressionYeastMutationinternal 6xHis (see supplement figure 4), amino a…PromoterGALAvailable SinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
GEPIR Sox4.2091
Plasmid#101118PurposeshRNA vecDepositorInsertSox4.2137
Available SinceOct. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJH063
Plasmid#243723PurposeExpresses a chimeric form of SUPV3L1, where the region between residue 114 and 351 is replaced by a 250-residue XTEN linkerDepositorInsertSUPV3L1(1-114aa)-XTEN250-SUPV3L1(351aa-stop) (SUPV3L1 Human)
UseLentiviralMutationThe region between residue 114 and 351 of SUPV3L1…Available SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDam-Myc-HP1
Plasmid#59221Purposeexpresses Dam-myc-HP1DepositorInsertHP1 (Su(var)205 Fly)
UseDamidTagsDam and mycExpressionInsectPromoterDrosophila heat shock promoterAvailable SinceMay 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21a - SodB
Plasmid#89613PurposeExpresses recombinant 6HIS tagged T. cruzi superoxide dismutase B protein in E. coli upon IPTG inductionDepositorInsertSuperoxide dismutase B
Tags6HIS and T7 tag (gene 10 leader)ExpressionBacterialAvailable SinceApril 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
LI C-D 11GFP
Plasmid#54431DepositorInsertsuperfolder GFP 11 domain
UseCloning vectorAvailable SinceNov. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
Farnesylated SE pcDNA3.1
Plasmid#79666PurposeExpresses super ecliptic A227D in mammalian cell membranesDepositorInsertsuperEcliptic pHluorin
ExpressionMammalianAvailable SinceJuly 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRSETb-rsGreenF
Plasmid#78181PurposeExpresses rsGreenF in E. coli strains.DepositorInsertrsGreenF
Tags6xHis-tag; Xpress tagExpressionBacterialPromoterT7Available SinceMay 27, 2016AvailabilityAcademic Institutions and Nonprofits only