We narrowed to 5,415 results for: mos
-
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCR3-vsv-AuroraB L154A/H250Y
Plasmid#108489Purposeexpression of vsv-AuroraB Analog sensitive (L154A/H250Y)DepositorInsertAuroraB (AURKB Human)
TagsVSVExpressionMammalianMutationAnalog sensitive L154A/H250YPromoterCMVAvailable SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
Adeno BN
Plasmid#101823PurposeAdenovirus for the expression of gRNAs targeting intron 13 of murine Bcan and intron 10 of murine Ntrk1DepositorUseAdenoviralTagsFLAG-Cas9Available SinceNov. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti CGIP + Z-AAT target
Plasmid#86007Purposelenti reporter plasmid with Z-AAT-specific gRNA target-sequence, to be used with tGFP #26864DepositorInsertsCAG promoter
Z-AAT target
UseLentiviralMutationV30MAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti CGIP + TTR target
Plasmid#86009Purposelenti reporter plasmid with TTR_V30M-specific gRNA target-sequence, to be used with tGFP #26864DepositorInsertsCAG promoter
TTR target
UseLentiviralMutationV30MAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
TK4-NLS-EGFP
Plasmid#239046PurposePiggyBac plasmid for stable transgene expression during human pluripotent stem cell differentiationDepositorInsertsEGFP
puroR-T2A-mycNLS-mTagBFP2
TagsT2A-mycNLS-mTagBFP2 and c-myc-NLSExpressionMammalianPromoterCAG and EF1aAvailable SinceMay 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAGT9054
Plasmid#219430PurposeTranscriptional unit (MoClo-position 2): 2x35Ss_Omega enhancer_PapE-4LF2-N-SpCas9i-N_tOCSDepositorInsertLB_2x35Ss-omega enhancer:PapE-4xLF2-NLS-SpCas9i-NLS:tOCS_RB (Position 2)
UseCRISPR; Moclo compatible level 1 module (position…TagsPapE-4LF2ExpressionPlantAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
TK4_SH4-1_targeting
Plasmid#254452PurposeTK4 targeting vector containing left and right homology arms for the SH4-1 locusDepositorInsertsmycNLS-mScarlet-T2A-mNeonGreen-PEST
puroR-T2A-mycNLS-mTagBFP2
UsePiggybacTagsPEST, T2A-mycNLS-mTagBFP2, and c-myc-NLSExpressionMammalianPromoterCAG and EF1aAvailable SinceApril 24, 2026AvailabilityAcademic Institutions and Nonprofits only -
GFP-UBR5
Plasmid#52050PurposeCMV driven mammalian expression of UBR5 with an N-termianl GFP fusionDepositorAvailable SinceMarch 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.neo_shGFP
Plasmid#110470PurposeControl, silence GFP gene, doxycycline inducible, neomycin selectionDepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterH1/TO (RNA PolIII)Available SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
BACE2_pcDNA6.2/EmGFP-Bsd
Plasmid#176942PurposeMammalian expression vector encoding BACE2 and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-Nppa-EGFP
Plasmid#247327PurposeExpresses EGFP under the control of the Nppa promoterDepositorInsertEGFP under the control of the Nppa Promoter
UseAAVExpressionMammalianPromoterNppa proximal promoterAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGEN-Vhh-LaminB-mNeonGreen-IRES-myr-BFP (JDW 1353)
Plasmid#229845PurposeA CAGGS-driven expression vector containing a vhh-Lamin nanobody for nuclear lamina labeling followed by an IRES and a myristoylated TagBFP for labeling the cell membrane.DepositorInsertLamin nanobody
ExpressionMammalianAvailable SinceFeb. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTol2-Ubi-zFucci-pA-exorh-GFP (JDW 1489)
Plasmid#242593PurposeA Tol2 expression vector containing the zebrafish Ubi promoter driving zFUCCI to label cell cycle state. Exorh-EGFP in the backbone to label pineal cells.DepositorInsertmCerulean-zGeminin, mCherry-zCdt1
UseZebrafish expressioPromoterzebrafish UbiAvailable SinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-SFFV-Zim3-dCas9-P2A-EGFP
Plasmid#188899PurposedCas9 with an N-term Zim3 KRAB-NLS fusion, a C-term HA-2xNLS, and GFP linked by a P2A site from a SFFV promoter with an upstream ubiquitous chromatin opening elementDepositorInsertZim3-dCas9
UseLentiviralTagsHA-2xNLS, P2A-GFP, and Zim3 KRAB-NLS fusionPromoterSFFVAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pmCherryC1 VAP-A KD/MD
Plasmid#226408PurposeExpression of human VAP-A (mutant K94D/M96D, unable to bind FFAT motifs) fused to mCherry in mammalian cellsDepositorInsertVAP-A (VAPA Human)
TagsT7-Xpress tag and mCherryExpressionMammalianMutationK94D/M96D mutant, unable to bind FFAT motifsAvailable SinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pmCherryC1 VAP-B KD/MD
Plasmid#226410PurposeExpression of human VAP-B (mutant K87D/M89D, unable to bind FFAT motifs) fused to mCherry in mammalian cellsDepositorInsertVAP-B (VAPB Human)
TagsHA, T7-Xpress tag, and mCherryExpressionMammalianMutationK87D/M89D mutant, unable to bind FFAT motifsAvailable SinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1-FHC-POLQ-DY2230AA
Plasmid#64878Purposelentiviral expression of human POLQ -DY2230AA mutant (a polymerase domain mutant)DepositorInsertPOLQ (POLQ Human)
UseLentiviralTagsFLAG and HAExpressionMammalianMutationD2330A,Y2331A, in the DNA polymerase domain (POL)…PromoterEF1alphaAvailable SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
Nluc CD63
Plasmid#242528PurposeThis plasmid can be used to quantify CD63 by luminescence signal upon providing substrate, in particular in the secretome, especially in the extracellular vesicles of cells expressing this construct.DepositorAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYLCRISPR/Cas9P35S-B
Plasmid#66190Purposeexpression of Cas9 in plants, cauliflower mosaic virus 35S promoter (P35S), basta selectionDepositorInsertCas9
ExpressionPlantMutationplant-codon optimized with higher GC contents (62…Promotercauliflower mosaic virus 35S promoter (P35S)Available SinceOct. 23, 2015AvailabilityAcademic Institutions and Nonprofits only