We narrowed to 27,023 results for: GFP
-
Plasmid#180379Purposelentiviral transduction of eGFP geneDepositorAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pSV40_mD6Ertd527e-HA-EGFP
Plasmid#192223PurposeExpresses murine mD6Ertd527e gene, C-terminally tagged with HA and EGFP, in mammalian cellsDepositorAvailable SinceNov. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pWPT-mEGFP
Plasmid#190606PurposeObtained by creating a deletion inside the mCherry coding sequence in pWPT-/GCCACC-mEGFP-IRES-mCherry (Addgene #49235)DepositorInsertsmEGFP
mCherry
UseLentiviralMutationa deletion was created in mCherry CDS impairing i…PromoterEIF1-shortAvailable SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
p09008_AF1-4+GFP5-7
Plasmid#173715PurposePlasmid backbone for the HyperXpress workflow containing new to nature hybrid GFP with strong fluorescence in E. coli cell free protein synthesis extracts.DepositorInsertshybrid GFP
mKate2
UseE. coli cell free protein synthesis extractsExpressionBacterialAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
T7-10-QUAS-GFP_ColE1
Plasmid#171657PurposeQUAS ten base pairs downstream of a T7 promoter. Expresses GFP in BL21(DE3) E. coli. Contains ColE1 origin of replication.DepositorInsertT7-10-QUAS
TagsssrA degradation tag (DAS+4)ExpressionBacterialPromoterT7Available SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
T7-15-QUAS-GFP_ColE1
Plasmid#171658PurposeQUAS fifteen base pairs downstream of a T7 promoter. Expresses GFP in BL21(DE3) E. coli. Contains ColE1 origin of replication.DepositorInsertT7-15-QUAS
TagsssrA degradation tag (DAS+4)ExpressionBacterialPromoterT7Available SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
T7-0-QUAS-GFP_ColE1
Plasmid#171650PurposeQUAS directly downstream of a T7 promoter. Expresses GFP in BL21(DE3) E. coli. Contains ColE1 origin of replication.DepositorInsertT7-0-QUAS
TagsssrA degradation tag (DAS+4)ExpressionBacterialPromoterT7Available SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
T7-5-QUAS-GFP_ColE1
Plasmid#171656PurposeQUAS five base pairs downstream of a T7 promoter. Expresses GFP in BL21(DE3) E. coli. Contains ColE1 origin of replication.DepositorInsertT7-5-QUAS
TagsssrA degradation tag (DAS+4)ExpressionBacterialPromoterT7Available SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-SpGalpha-i
Plasmid#185568Purposeto see protein dynamicsDepositorInsertGalpha-i
UseIn vitro transcription (mrna synthesis)TagsGFP, S-TagAvailable SinceOct. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG1
Plasmid#188967PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtggaaaacaatgcgaccgactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
phABCA3-eGFP_CRISPR_Donor
Plasmid#188540PurposeHomologous recombination donor plasmid for CRISPR/Cas9 targeting of GFP fusion protein to the stop codon of endogenous human ABCA3 gene locusDepositorInsertEGFP
UseCRISPR; Donor for homologous recombinationAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG2
Plasmid#188968PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGFP-nE-mHP1alpha
Plasmid#181895PurposeFluorescently tagged HP1alpha, serines in N-terminal extension (NTE) replaced by glutamatesDepositorInsertnE-mHP1alpha (Cbx5 Mouse)
TagsGFPExpressionMammalianMutationS11E, S12E, S13E, S14EPromoterCMVAvailable SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
R6K_BAD_GFP-mCherry_ChInt++
Plasmid#187393Purposechromosomal integration downstream of glmS gene via Tn7 system of a cassette encoding for arabinose-inducible GFP and mCherryDepositorInsertGFP, mCherry
ExpressionBacterialAvailable SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
R6K_BAD_GFP-mCherry_ChInt--
Plasmid#187394Purposechromosomal integration downstream of glmS gene via Tn7 system of a cassette encoding for arabinose-inducible GFP and mCherryDepositorInsertGFP, mCherry
ExpressionBacterialAvailable SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
R6K_BAD_mCherry-GFP_ChInt--
Plasmid#187396Purposechromosomal integration downstream of glmS gene via Tn7 system of a cassette encoding for arabinose-inducible GFP and mCherryDepositorInsertGFP, mCherry
ExpressionBacterialAvailable SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pILGFP10CF72 (B11)
Plasmid#185859PurposeTesting the SkGAL2 promoter inserted with 2 PZ4 element using a green fluorescent protein as the reporterDepositorInsertPURA3>KlURA3>TAgTEF1- PSkGAL2M3(2*PZ4)>(BamHI)yEGFP>TURA3
ExpressionYeastMutationNoneAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28a-eGFP-P(11)4
Plasmid#185786PurposeEncodes enhanced green fluorescent protein linked to P(11)4 self-assembling peptide via a GS-linker sequenceDepositorInserteGFP-P(11)4
TagsHis-tagExpressionBacterialPromoterT7Available SinceAug. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti_EGFP-P2A_truncHaus6_IRES_Blast
Plasmid#182885PurposeTransfer vector for production of lentivirus. Control plasmid for rescue experiment of HAUS6 depletion phenotype, containing a nonsense mutation and a truncation in HAUS6.DepositorInsertHAUS 6 (HAUS6 Human)
UseLentiviralExpressionBacterial and MammalianMutationstop codon introduced 2 amino acids downstream of…PromoterEF1alpha coreAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT22UbGfpnE4PCh(#301)
Plasmid#184066Purposecyclofen-inducible GFP nuclear relocation in zebrafish permanent transgenicDepositorInserteGFP-nls-ERT2-P2A-mCherry
UseZebrafish transgenesis (blue eyes)MutationERT2: G400V, M543A, L544A, deleted 1-281;PromoterZf-UbiAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only