We narrowed to 10,958 results for: AGA
-
Plasmid#237640PurposeFor overexpression of mEGFP-NUP98-DDX10DepositorUseTagsmEGFPExpressionMammalianMutationPromoterAvailable sinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only
-
Fucci(CA) hCdt1-iRFP hGeminin-iRFP
Plasmid#190182PurposeFluorescent reporter vector for visualization of G0 and other cell cycle phases.DepositorInsertsUseTagsExpressionBacterial and MammalianMutationPromoterCMVAvailable sinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT2-shP53
Plasmid#124261PurposeExpresses shRNA targeting P53. Construct has inverted repeats to be used in Sleeping beauty system.DepositorInsertshP53
UseTagsExpressionMammalianMutationPromoterAvailable sinceApril 8, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pRK5_mEGFP-TAZ-CAMTA1-KS
Plasmid#237677PurposeFor overexpression of mEGFP-TAZ-CAMTA1-KSDepositorUseTagsmEGFPExpressionMammalianMutationPromoterAvailable sinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 Sox2 HM a
Plasmid#26353DepositorInsertSox2 shRNA
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterAvailable sinceSept. 22, 2010AvailabilityAcademic Institutions and Nonprofits only -
pNCS-mGold2t
Plasmid#231766PurposeExpression of mGold2t in bacterial cellsDepositorInsertmGold2t
UseTagsExpressionBacterialMutationmGold2t is mGold with V1A;V22I;H77N;Q80R;K101E;D1…PromoterSynthetic promoterAvailable sinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-iGluSnFR4s-PDGFR-WPRE
Plasmid#234435PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and slow deactivation kinetics (4s = slow); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4s-PDGFR
UseAAVTagsIgK chain and Myc epi tag-PDGFR TM DomainExpressionMammalianMutationPromoterSynapsinAvailable sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOTTC763 - pX458 with rat Rosa26 gRNA A
Plasmid#113161PurposeA plasmid that expresses a guide RNA targeting rat Rosa26 as well as FLAG-tagged SpCas9 and GFPDepositorInsertgRNA for rat Rosa26
UseCRISPRTagsExpressionMammalianMutationPromoterhU6Available sinceFeb. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3ExpressionMutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…PromoterAvailable sinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-MPSV-eBFP2
Plasmid#220472PurposeExpresses either functional CRISPR gRNAs from the hU6-promotor and empowers pairing of CRISPR screens with 3' and 5' scRNA-Seq capturing by FACS-sorting on eBFP2+ without prior resistance selectionDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDL52 (clone45)
Plasmid#188578PurposeHigh-yield production of coenzyme F420 in E. coliDepositorInsertsribA
ribD
yigB
fbiC
cofC
cofD
cofI
cofE
UseTagsExpressionBacterialMutationCodon optimization, synthetic ribosome binding si…PromoterT7 variantsAvailable sinceSept. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
EGFP-p300 (D1399Y)
Plasmid#191763PurposeExpression of EGFP fused to catalytically dead core p300 histone acetyltransferase (D1399Y)DepositorInsertFRB-EGFP-p300 core (D1399Y) (EP300 Human)
UseTagsEGFP (N-terminal of p300 core (D1399Y)) and FRB (…ExpressionBacterial and MammalianMutationcatalytic D1399Y mutation in p300PromoterEF1alphaAvailable sinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 Sox2 3H b
Plasmid#26352DepositorInsertSox2 shRNA
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterAvailable sinceSept. 22, 2010AvailabilityAcademic Institutions and Nonprofits only -
pTBL716 4xHRE-YB-TATA-Cas9-ODD-T2A-TdT
Plasmid#132667PurposeExpresses hypoxia-inducible Cas9 and TdT in mammalian cells.DepositorInsertCas9-ODD-T2A-TdT (DNTT Streptococcus pyogenes, Human)
UseTagsExpressionMammalianMutationPromoter4xHRE_YB TATAAvailable sinceNov. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-iGluSnFR4s-PDGFR-WPRE
Plasmid#234445PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and slow deactivation kinetics (4s = slow); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4s-PDGFR
UseAAVTagsIgK chain and Myc epi tag-PDGFR TM DomainExpressionMammalianMutationPromoterGFAPAvailable sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQCXIP-mCherry-Halo-YAP1
Plasmid#128336PurposeRetrovirus construct to express mCherry-Halo-YAP1DepositorInsertYAP1 (YAP1 Human)
UseRetroviralTagsmCherry and Halo-tagExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNTK human MBD3 PGK-Neo-pA flox
Plasmid#52362PurposeTargeting vector for Human MBD3 conditional knockout. Also creates hypomorphic alleles.DepositorInsertMBD3 (MBD3 Human)
UseTargetingTagsExpressionMutationPromoterAvailable sinceSept. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-iGluSnFR4f-PDGFR-WPRE
Plasmid#234446PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and fast deactivation kinetics (4f = fast); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4f-PDGFR
UseAAVTagsIgK chain and Myc epi tag-PDGFR TM DomainExpressionMammalianMutationPromoterGFAPAvailable sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
lucMAPT-30D
Plasmid#214672PurposeMAPT Exon 10 reporter containing the MS2 hairpin 30 base pairs downstream of the 5′ splice siteDepositorInsertMAPT (MAPT Human)
UseTagsFirefly Luciferase, Renilla Luciferase, and V5ExpressionMammalianMutationContains Exon 9, Exon 10 with a mutation to intro…PromoterCMVAvailable sinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
lucMAPT-30U
Plasmid#214673PurposeMAPT Exon 10 reporter containing the MS2 hairpin 30 base pairs upstream of the 3′ splice siteDepositorInsertMAPT (MAPT Human)
UseTagsFirefly Luciferase, Renilla Luciferase, and V5ExpressionMammalianMutationContains Exon 9, Exon 10 with a mutation to intro…PromoterCMVAvailable sinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
A3Bi-ctd-Cas9n-UGI-NLS
Plasmid#109426PurposeExpresses the C-terminal catalytic domain of human APOBEC3B containing an L1 intron fused to Cas9n, Uracil DNA Glycosylase Inhibitor, with a nuclear localization signal.DepositorInsertApolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-like 3B C-terminal domain (APOBEC3B Human)
UseCRISPRTagsExpressionMammalianMutationInsertion of an L1 intron into the coding sequenc…PromoterCMVAvailable sinceJuly 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
MAGI1 gRNA (BRDN0001487062)
Plasmid#78068Purpose3rd generation lentiviral gRNA plasmid targeting human MAGI1DepositorInsertMAGI1 (MAGI1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS puro HA-hUSP27X
Plasmid#225718PurposeBacterial expression of USP27X with HA tagDepositorInsertUSP27X (USP27X Human)
UseTagsHAExpressionMammalianMutationPromoterAvailable sinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
AIP(WT)-mChF-giantin
Plasmid#61523PurposeExpression of human golbin B1 and FK506 binding protein 1A (FKBP1A) tagged with mCherry and AIPDepositorUseTagsAIP and mCherryExpressionMammalianMutationPromoterCMVAvailable sinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuet-FBXL5-SKP1
Plasmid#226620PurposeCo-expression of FBXL5-SKP1 complex in E.coliDepositorUseTagsGB1ExpressionBacterialMutationAmino acids 1-198 was deleted, and 420-596 was re…PromoterT7Available sinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
CMV-NanoLuc-BRAF-CAT
Plasmid#194772PurposeMammalian expression construct encoding the BRAF catalytic (CAT) domain (AA 435-766) with an N-terminal NanoLuc tag.DepositorInsertBRAF catalytic (CAT) domain (AA 435-766) (BRAF Human)
UseTagsNanoLucExpressionMammalianMutationPromoterCMV51Available sinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
CMV-BRAF-REG-Halo
Plasmid#194771PurposeMammalian expression construct encoding the BRAF regulatory (REG) domain (AA 1-435) with a C-terminal HaloTag.DepositorInsertBRAF regulatory (REG) domain (AA 1-435) (BRAF Human)
UseTagsHaloTagExpressionMammalianMutationPromoterCMV51Available sinceFeb. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
mRFP-FKBP12-5ptpase domain
Plasmid#67516PurposeRecruitable human type IV 5-phosphatase domain (214-644)DepositorUseTagsmRFPExpressionMutationINPP5E has C641A to destroy the C-terminal CAAX d…PromoterAvailable sinceSept. 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
pDL52 (clone76)
Plasmid#188579PurposeHigh-yield production of coenzyme F420 in E. coliDepositorInsertsribA
ribD
yigB
fbiC
cofC
cofD
cofI
cofE
UseTagsExpressionBacterialMutationCodon optimization, synthetic ribosome binding si…PromoterT7 variantsAvailable sinceSept. 7, 2022AvailabilityAcademic Institutions and Nonprofits only