We narrowed to 18,346 results for: multi
-
Plasmid#72304PurposeCombines a gCaMP-based calcium indicator and an Arch-based voltage indicatorDepositorInsertCaViar
UseLentiviralTagsTSExpressionMammalianPromoterCaMKIIaAvailable sinceMay 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGL4.26-SS-352
Plasmid#68791PurposeZF9 Op x6 -- GFP-IRES-NTRDepositorInsertsZF9 Op 6x
EGFP
Nitroreductase
TagsIRESExpressionMammalianAvailable sinceOct. 19, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pKE4-I-SceI-fabp10a:Xpt-β-cat, cryaa:Venus
Plasmid#105127PurposeUsed along with I-SceI enzyme to generate transgenic zebrafish expressing hepatocyte-specific Xenopus activated beta-catenin and lens-specific Venus fluorescent proteinDepositorInsertsUseZebrafish transgenesisPromotercryaa (crystallin) and fabp10aAvailable sinceApril 17, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pGM1202
Plasmid#69615Purposeinducible gene expression in Streptomyces, C-terminal His-tag encoding sequenceDepositorInsertsaac
tsr
rep
sso
TipA promoter
dso
Available sinceJan. 12, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJ3 SHP2 D61A
Plasmid#8320DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSHP2 (PTPN11 Human)
ExpressionMammalianMutationD61A (activated mutant)Available sinceJune 17, 2005AvailabilityAcademic Institutions and Nonprofits only -
pMC037-HisMS2_PLP_pac
Plasmid#128233PurposeExpression construct for MS2 phage like particles with Esp3I cloning sites for packaged RNA.DepositorInsertsMaturation Protein
Coat Protein Dimer
ExpressionBacterialPromoterT7Available sinceNov. 15, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pRS415_pGal-nCas9(D10A)
Plasmid#79618PurposeExpresses nCas9(D10A) in yeast cellsDepositorPublicationInsertSpCas9
ExpressionYeastMutationD10A for nickase Cas9PromoterpGal1Available sinceJuly 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pYPQ134B2.0
Plasmid#167158PurposeGolden Gate entry vector to express the 4th gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under AtU3 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterAtU3Available sinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
p101_CRISPRai_PiggyBac
Plasmid#213777PurposeExpresses Tet-On inducible CRISPRai orthogonal system with VPR-dSaCas9, dSpCas9-KRAB-BFP, zeocin resistance gene, and Tet-On transactivator. PiggyBac vector.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsVPR-dSaCas9
dSpCas9-KRAB-BFP
zeocin
Tet-On transactivator
UseCRISPRPromoterEF1a (EF-1-alpha intron a) and Tet_On_TREAvailable sinceMay 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti_EF1a_EV
Plasmid#183116PurposeEmpty vector control for pLenti_EF1a constructsDepositorInsertSmall multiple cloning site
UseLentiviralExpressionMammalianPromoterEF1aAvailable sinceAug. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pR0306 CcaCas13b His6-TwinStrep-SUMO
Plasmid#182687PurposeExpresses CcaCas13b with N terminal 6xHis-SUMO tag for recombinant bacterial expression and purificationDepositorInsertCcaCas13b
TagsSUMOExpressionBacterialPromoterT7Available sinceApril 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJW1662
Plasmid#112050PurposeC-terminal tag with - AID*(AtIAA17_71-114)-HA and OsTIR1 expression cassette marked with LEUDepositorInsertsIAA17
TIR1
TagsHAExpressionYeastMutationonly amino acids 71-114PromoterADH1 and NoneAvailable sinceOct. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-RAB-EKARev-NLS
Plasmid#118476PurposeddRFP-based single-color ERK biosensor targeted to the nucleus.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertRAB-EKARev-NLS
Tags6xHIS, Nuclear localization signal (NLS), T7 tag …ExpressionMammalianPromoterCMVAvailable sinceMay 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
BB3cH_pGAP_23*_pLAT1_Cas9
Plasmid#104907PurposehCas9 under control of LAT1 for direct cloning of HH-sgRNA-HDV PCR products for episomal expression in P. pastoris and selection on HygDepositorInsertsHH - FS23 linker - HDV
human codon-optimized hcas9 sequence fused to a nuclear localization signal (NLS)
UseCRISPRExpressionYeastAvailable sinceJan. 30, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pRK5 FLAG DEPTOR (DEP domains)
Plasmid#21700DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertDEPTOR DEP domains (DEPTOR Human)
TagsFLAGExpressionMammalianMutationDEP domains onlyAvailable sinceJuly 28, 2009AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLKO mouse shRNA 1 DEPTOR
Plasmid#21337DepositorAvailable sinceJuly 7, 2009AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCDF-Frb-v1
Plasmid#201923PurposeE. coli vector expressing FrbA, FrbB, FrbC, FrbD and FrbE for the biosynthesis of non-hydrolyzable phosphoserine from phosphoenolpyruvate.DepositorInsertsFrbA
FrbB
FrbC
FrbD
FrbE
ExpressionBacterialPromoterT7 (modified), T7 (modified, moderate), T7 (modif…Available sinceJune 7, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pTwist-SARS-CoV-2 Δ18 B.1.351v2
Plasmid#169463PurposeEncodes SARS-CoV-2 B.1.351v2 Spike Protein lacking 18 C-terminal amino acids for pseudovirus productionDepositorInsertSARS-CoV-2 B.1.351v2 Spike truncated to remove 18 amino acids (S )
ExpressionMammalianAvailable sinceJune 21, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDicAID_nCas9-PmCDA-2A-NptII_ETR
Plasmid#91695PurposeDicot Target-AID vector expressing dicot-optimized nCas9-PmCDA1-2A-NptII with sgRNA targeting SlEtrDepositorInsertSpCas9
TagsPmCDA1ExpressionPlantMutationD10A for nickase Cas9PromoterPcUbiAvailable sinceJune 6, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
M-tdTom-SP
Plasmid#48677PurposeMammalian tdTomato activation reporter for SP with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, SP-PAM, and tdTomato reporter. Compatible with S. pyogenes Cas9
UseCRISPRPromoterSp6Available sinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by