We narrowed to 18,241 results for: multi
-
Plasmid#91695PurposeDicot Target-AID vector expressing dicot-optimized nCas9-PmCDA1-2A-NptII with sgRNA targeting SlEtrDepositorInsertSpCas9
TagsPmCDA1ExpressionPlantMutationD10A for nickase Cas9PromoterPcUbiAvailable sinceJune 6, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
M-tdTom-SP
Plasmid#48677PurposeMammalian tdTomato activation reporter for SP with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, SP-PAM, and tdTomato reporter. Compatible with S. pyogenes Cas9
UseCRISPRPromoterSp6Available sinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEntr-Nkx2-5flbio
Plasmid#32969DepositorAvailable sinceJan. 9, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pHR_Gal4UAS_humanIL-2_IRES_mCherry_PGK_tBFP
Plasmid#85426PurposeLentiviral vector for Gal4 inducible humanIL-2 with mCherry reporter and constitutive tBFP expressionDepositorInserthuman IL-2
UseLentiviralAvailable sinceAug. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBADZ-HisCre
Plasmid#111187PurposeHelper plasmid containing Cre-recombinase gene, which is expressed in DH10MultiBac cellsDepositorInsertCre recombinase
TagsHis tagExpressionBacterialAvailable sinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEVOL_PylRS(AF)-tRNA
Plasmid#223511PurposePylRS (AF)/tRNA Pyl orthogonal pair for genetic code expansion that allows site-specific incorporation of noncanonical amino-acids into a POI using the Amber stop codonDepositorInsertsTags6xHisExpressionBacterialMutationY306A; Y384FPromoteraraBAD, rrnB, and glnS and proKAvailable sinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2FE-ABE8e-SpRY
Plasmid#213008PurposeA lentiviral vector expressing the ABE8e-SpRY base editor and an sgRNA cloning siteDepositorInsertABE8e-SpRY-D10A
UseCRISPR and LentiviralExpressionMammalianMutationD10A nickase variant of SpRYPromoterEf-1aAvailable sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEJS887_pTetR-P2A-BFPnls/sgAlpha
Plasmid#108651PurposeAlpha satellite repeats targeting Spy sgRNA under U6 promoterDepositorInsertsAlpha satellite repeats targeting sgRNA
TetR-P2A-BFP
UseCRISPR and LentiviralTagsNoExpressionMammalianPromoterU6 and hPGKAvailable sinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
Cyan Nano-lantern/pcDNA3
Plasmid#67660Purposecyan luminescent protein for high-speed single-cell and whole body imagingDepositorInsertCyan Nano-lantern
ExpressionMammalianAvailable sinceSept. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
ACTIN-SOX2-PGK Cre
Plasmid#59019PurposeBicistronic Lentivirus expressing sox2 and CreDepositorAvailable sinceSept. 17, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pYPQ132-tRNA2.0
Plasmid#158394PurposeGolden Gate entry vector to express the 2nd gRNA with tRNA2.0 scaffold (with four MS2 binding sites) without promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterWithout promoterAvailable sinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
Halo-TNFa-RUSH
Plasmid#166901PurposeRUSH cargo: Str-KDEL_IRES_Tumor Necrosis Factor alpha (TNFa)-SBP-HaloDepositorInsertHaloTag
ExpressionMammalianAvailable sinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pTK095
Plasmid#59560PurposeSIN SP6 P1234 (nsP2 P726S) SGP(14) Kozak L7Ae-P2A-EYFP 4xFF4 8xMS2DepositorInsertSGP(14) Kozak L7Ae-P2A-EYFP 4xFF4 8xMS2
Available sinceAug. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG12D/sgKras/Cre
Plasmid#99851PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12D mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available sinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTUM4
Plasmid#230905PurposePlasmid encoding four periplasmic folding helper proteins to boost the secretion of functional heterologous proteins in E. coliDepositorInsertsExpressionBacterialAvailable sinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCVL.SSA TLR (Sce)
Plasmid#45576PurposeCodes for the SSA-TLR with the target site for I-Sce I in a lentiviral backboneDepositorPublicationInserts5' iRFP arm
eGFP with I-Sce I TS
+3 mCherry
3' iRFP arm
UseLentiviralExpressionBacterial and MammalianMutationembedded I-Sce I TS from 163-185bp, truncated 25 …PromoterSFFVAvailable sinceNov. 4, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMX-Flag-WIP
Plasmid#11772DepositorAvailable sinceFeb. 15, 2007AvailabilityAcademic Institutions and Nonprofits only -
pCAG-BRCA1
Plasmid#119007PurposeMammalian expression of human BRCA1 and BFPDepositorAvailable sinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
Tol2-CAG::Palmbow
Plasmid#158993PurposeMulticolor membrane-restricted labeling with a genome-integrating Tol2 transposon vector (randomly expressing palmitoylated mCherry, mEYFP or mCerulean upon Cre recombination)DepositorInsertPalmbow
TagsThe default expressed EBFP2 is fused to H2B; oth…ExpressionMammalianPromoterCAGAvailable sinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCasTet-λ
Plasmid#128318PurposeConstitutive expression of cas9 and anhydrotetracycline/tetracycline inducible expression of lamda RED. Useful variant of Plasmid #62225 when arabinose induction is not possible.DepositorInsertTetR and pTetR/TetO
UseCRISPR and Synthetic BiologyExpressionBacterialMutationConstitutive expression of cas9 and anhydro-tetra…Promotertet promoterAvailable sinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only