We narrowed to 4,713 results for: crispr c plasmids
-
Plasmid#129091PurposeKI KRAS G12V mutation into human KRAS locusDepositorAvailable SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only
-
LCV2_mClover3_LacZ
Plasmid#155103Purposelentiviral plasmid expressing mClover3, Cas9 and a gRNA targeting LacZDepositorInsertLacZ_sgRNA_2
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
LCV2_mCherry_LacZ_sgRNA
Plasmid#155108Purposelentiviral plasmid expressing mCherry, Cas9 and a gRNA targeting LacZDepositorInsertLacZ_sgRNA_2
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
LCV2_mCherry_Luciferase_sgRNA
Plasmid#155109Purposelentiviral plasmid expressing mCherry, Cas9 and a gRNA targeting LuciferaseDepositorInsertLuciferase_sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAP114
Plasmid#120799PurposeE. coli-C. difficile shuttle vector for xylose-inducible expression in C. difficile; Pxyl driving expression of red fluorescent protein (mCherryOpt)DepositorInsertPxyl::mCherryOpt
ExpressionBacterialMutation1.4 kb xylR-Pxyl DNA fragment from C. difficile R…PromoterPxylAvailable SinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET-A3A(N57Q)-BE3
Plasmid#158157PurposeT7 promoter bacterial expression plasmid for hAPOBEC3A(N57Q)-BE3 with N-terminal 6xHis-tag and C-terminal SV40 NLSDepositorInsert6xHis-hA3A(N57Q)-XTEN linker-hSpCas9n(D10A)-UGI-SV40NLS
Tags6xHis tag on N-terminusExpressionBacterialPromoterT7Available SinceNov. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 2-exon 8
Plasmid#163321PurposeSpCas9 ILK gRNA 2 (G*ACATTGTAGAGGGATCCATA), targeting exon 8 within the C-terminal protein kinase domain.DepositorInsertILK gRNA 2_Exon8
UseCRISPRExpressionMammalianPromoterU6FAvailable SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIG-755_HA-GD2-28z_CAR_RFP-JUN
Plasmid#207494PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertRFP-JUN, HA-GD2-28z_CAR (JUN Human)
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
ABE8e-Cas9NG
Plasmid#203328PurposePlasmid for bacterial purification of codon optimized ABE8e-Cas9NGDepositorInsertABE8e-Cas9NG
UseCRISPRTagsHis-tagExpressionBacterialAvailable SinceOct. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV_Cas9–superNLS
Plasmid#232430PurposeExpression plasmid for the SpCas9 nuclease with superNLSDepositorInsertCas9–superNLS
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV_ABE8e–superNLS
Plasmid#232429PurposeExpression plasmid for the ABE8e base editor with superNLSDepositorInsertABE8e–superNLS
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX458-3xHA-en31FnCas9ABEmax8.17d
Plasmid#201956PurposeMammalian expression plasmid of en31FnCas9ABEmax8.17d base editor with T2A-EGFP and cloning backbone for sgRNADepositorInsertbpNLS-en31FnCas9ABEmax8.17d-bpNLS-3xHA-T2A-EGFP
UseCRISPRTags3xHA, NLS, and T2A-EGFPExpressionMammalianPromoterCbhAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
Cdk13_intron3_sg3_pX458
Plasmid#127338PurposesgRNA that cuts within intron 3 of mouse CDK13 genomic locus- guide #3DepositorInsertMouse Cdk13 Intron 3 sgRNA
UseCRISPR and Mouse TargetingPromoterU6 PromoterAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Cdk13_intron4_sg4_pX330
Plasmid#127341PurposesgRNA that cuts within intron 4 of mouse CDK13 genomic locus- guide #4DepositorInsertMouse Cdk13 Intron 4 Targeting sgRNA
UseCRISPR and Mouse TargetingPromoterU6 PromoterAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
PX458-3xHA-dSpCas9
Plasmid#201953PurposeMammalian expression plasmid of dead SpCas9 with T2A-EGFP and cloning backbone for sgRNADepositorInsert3xHA-NLS-dSpCas9-T2A-EGFP
UseCRISPRTags3xHA, NLS, and T2A-EGFPExpressionMammalianMutationD10A and H840A on SpCas9PromoterCbhAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
AP1muA-Halo-ALFA-polyA-G418 HR
Plasmid#229681PurposeHomology repair plasmid for endogenous tagging of AP1muA at the C-terminus with HaloTag and an ALFA tag. Contains a G418 resistance cassette for selection of edited cells.DepositorAvailable SinceJan. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
AP1muA-SNAP-V5-polyA-Puro HR
Plasmid#229680PurposeHomology repair plasmid for endogenous tagging of AP1muA at the C-terminus with SNAP tag and a V5 epitope tag. Contains a puromycin resistance cassette for selection of edited cells.DepositorAvailable SinceJan. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CASI-InteinC-SpRY C aa714-1368-U6-Camk2d sgRNA
Plasmid#209788PurposeExpresses SpRY cas9C by the constitutive CASI promoter and sgRNA targeting the oxidative activation sites of Camk2d by U6 promoterDepositorInsertSpRY C, Camk2d sgRNA
UseAAVPromoterCASIAvailable SinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
N-Terminal Split Cas9 D10A Nickase with GyrA intein
Plasmid#58695PurposeExpresses N-terminus of D10A SpCas9 nickase domain fused to a GyrA intein, flanked by ITRs for AAV packaging. Combine with C-Terminal Split Cas9 Gyra Intein for full length SpCas9 nickase productionDepositorInsertD10A Nickase humanized S. pyogenes Cas9 with Gyra Nsplit Intein
UseAAV and CRISPRTagsGyrA Nsplit Intein, HA Tag, and NLSExpressionMammalianMutationD10A nickase converting mutation to SpCas9PromoterCBhAvailable SinceSept. 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDD282
Plasmid#66823PurposeGFP^SEC^3xFlag vector with ccdB markers for cloning homology armsDepositorInsertGFP-C1^SEC^3xFlag
UseCRISPR and Cre/LoxTags3xFlag and C. elegans codon-optimized GFPExpressionWormAvailable SinceJune 26, 2015AvailabilityAcademic Institutions and Nonprofits only