We narrowed to 4,510 results for: Erf
-
Plasmid#71950PurposeExpresses the entire Islr protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pCMV_SEPT9_i1-i5-msfGFP
Plasmid#180332Purposemammalian expression of human SEPT9_i1-i5 fused to monomeric superfolder GFPDepositorInsertSEPTIN9_v7 (SEPTIN9 Human)
TagsmsfGFPExpressionMammalianMutationSEPT9_i1-i5PromoterCMVAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-hIRF5-V5(4D)-LPETG
Plasmid#237225PurposeExpresses LPETG-tagged, constitutively active human IRF5 variant in bacteriaDepositorInsertInterferon regulatory factor 5 (IRF5 Human)
Tags6xHisExpressionBacterialMutationS451D, S453D, S456D, S462DAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330_TFAP2C_cterm
Plasmid#222916PurposeCas9/sgRNA plasmid for targeting TFAP2CDepositorInsertCas9, TFAP2C sgRNA (TFAP2C Synthetic, Human)
UseCRISPRAvailable SinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
mEos3.2trLATm2allL+A
Plasmid#203750PurposeEncodes the transmembrane domain from human LAT with mEos3.2 fused on the C terminus. Residues within the transmembrane domain mutated to L and A to increase the TMD interfacial surface area with the membrane. Used as a fluorescent plasma membrane probe.DepositorAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
EGFP-MYO10-FERM-ITGBD
Plasmid#194855PurposeExpress EGFP-MYO10 with mutations (S2001_F2002insA/T2009D) that interfere with ITGB binding in mammalian cells.DepositorInsertMYO10 S2001_F2002insA/T2009D (MYO10 Human)
TagsEGFPExpressionMammalianMutationMYO10 has the following mutations S2001_F2002insA…PromoterCMVAvailable SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i1 S111F-msfGFP
Plasmid#180340Purposemammalian expression of human SEPT9_i1 S111F fused to monomeric superfolder GFPDepositorInsertSEPTIN9_v1 (SEPTIN9 Human)
TagsmsfGFPExpressionMammalianMutationSEPT9_i1 S111FPromoterCMVAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i1 R106W-msfGFP
Plasmid#180339Purposemammalian expression of human SEPT9_i1 R106W fused to monomeric superfolder GFPDepositorInsertSEPTIN9_v1 (SEPTIN9 Human)
TagsmsfGFPExpressionMammalianMutationSEPT9_i1 R106WPromoterCMVAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i1 NCmut1-msfGFP
Plasmid#180329Purposemammalian expression of human SEPT9_i1 NCmut1 fused to monomeric superfolder GFPDepositorInsertSEPTIN9_v1 (SEPTIN9 Human)
TagsmsfGFPExpressionMammalianMutationSEPT9_i1 R289A R290A K291A K294APromoterCMVAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i1 D10-25-msfGFP
Plasmid#180334Purposemammalian expression of human SEPT9_i1 D10-25 fused to monomeric superfolder GFPDepositorInsertSEPTIN9_v1 (SEPTIN9 Human)
TagsmsfGFPExpressionMammalianMutationSEPT9_i1 D10-25PromoterCMVAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i1 DN7-msfGFP
Plasmid#180335Purposemammalian expression of human SEPT9_i1 DN7 fused to monomeric superfolder GFPDepositorInsertSEPTIN9_v1 (SEPTIN9 Human)
TagsmsfGFPExpressionMammalianMutationSEPT9_i1 DN7PromoterCMVAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i1 Gmut-msfGFP
Plasmid#180331Purposemammalian expression of human SEPT9_i1 Gmut fused to monomeric superfolder GFPDepositorInsertSEPTIN9_v1 (SEPTIN9 Human)
TagsmsfGFPExpressionMammalianMutationSEPT9_i1 W520A, H530DPromoterCMVAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i1 NCmut2-msfGFP
Plasmid#180330Purposemammalian expression of human SEPT9_i1 NCmut2 fused to monomeric superfolder GFPDepositorInsertSEPTIN9_v1 (SEPTIN9 Human)
TagsmsfGFPExpressionMammalianMutationSEPT9_i1 I281D, M288DPromoterCMVAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSUMO R106L-CPTP
Plasmid#170737PurposeThe plasmids contain inserts (ORFs) for expressing various members of the GlycoLipid Transfer Protein (GLTP) superfamily.DepositorAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSUMO K60A-CPTP
Plasmid#170736PurposeThe plasmids contain inserts (ORFs) for expressing various members of the GlycoLipid Transfer Protein (GLTP) superfamily.DepositorAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.1 LIC 6A NLRP1-FLAG LL1193EE
Plasmid#166805PurposeMammalian cell expression vector for FLAG-tagged NLRP1. The LL1193E mutant abolishes FL-NLRP1 association with DPP9 at interface I.DepositorAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.1 LIC 6A NLRP1-FLAG K1277E
Plasmid#166808PurposeMammalian cell expression vector for FLAG-tagged NLRP1. The K1277E mutant abolishes interface III UPA-UPA contacts, DPP9 binding, and inflammasome activityDepositorAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.1 LIC 6A NLRP1-FLAG H1276G
Plasmid#166807PurposeMammalian cell expression vector for FLAG-tagged NLRP1. The H1276G mutant abolishes interface III UPA-UPA contacts, DPP9 binding, and inflammasome activityDepositorAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.1 LIC 6A NLRP1-FLAG P1214R
Plasmid#166806PurposeMammalian cell expression vector for FLAG-tagged NLRP1. The P1214R patient mutant abolishes NLRP1-CT association with DPP9 at interface II.DepositorAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only