We narrowed to 14,450 results for: cas9 genes
-
Plasmid#170548PurposeExpresses a sgRNA for 5' tagging to VIM and contains a cassette with eGFP without homology armsDepositorInsertsgRNA targeting 5'- end of VIM
UseCRISPR and LentiviralPromoterU6Available SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDIV495
Plasmid#177702PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAaGCAGATTAAtGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SRC1p (Debaryomyc…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSC45
Plasmid#104819PurposeCRISPR/Cas9 1xplex gRNA targeting Glyma.04g057400 (Dcl3a-2). Also expresses Cas9 from Gmubi promoter.DepositorInsertGlyma.04g057400
UseCRISPRExpressionPlantAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC29
Plasmid#104803PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr4g094545 (Hen1). Also expresses Cas9 from Gmubi promoter.DepositorInsertMedtr4g094545
UseCRISPRExpressionPlantAvailable SinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHDR-USR-eGFP
Plasmid#208830PurposeHDR Universal Surrogate Reporter with a sgRNA and consistently expressed eGFP but without Cas9. The selective PuroR reporter gene was designed to be repaired only by the sgRNA/Cas9-triggered HDR.DepositorTypeEmpty backboneExpressionMammalianPromoterCMV, U6Available SinceNov. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
TLCV2
Plasmid#87360PurposeLentiCRISPR v2 was modified into an all-in-one dox inducible system. The addition of doxycycline induces Cas9-2A-eGFP. The U6 promoter drives constitutive sgRNA expression.DepositorHas ServiceCloning Grade DNAInsertCas9-2A-eGFP
UseCRISPR and Lentiviral; Doxycycline inducible; egf…TagsCas9-T2A-eGFPExpressionMammalianPromoterTight TRE promoterAvailable SinceFeb. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSpCTRE-CD4
Plasmid#114010PurposeDox-inducible Cas9 expression with a CD4 selection markerDepositorInsertSpCas9
UseCRISPR and LentiviralExpressionMammalianAvailable SinceMarch 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
AIO-Puro
Plasmid#74630PurposeAll-in-One plasmid encoding dual U6 promoter-driven sgRNAs and Cas9-D10A nickase linked via 2A peptide with puromycin resistant marker to enhance efficient and accurate genome editingDepositorTypeEmpty backboneUseCRISPRTagsPuromycin resistant markerExpressionMammalianPromoterCbhAvailable SinceMay 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSP1673
Plasmid#65769PurposeBacterial expression plasmid for S. thermophilus1 Cas9 & sgRNA (need to clone in spacer into BspMI sites): T7-humanSt1Cas9-NLS-T7-BspMIcassette-St1-sgRNADepositorInsertmammalian codon-optimized Streptococcus thermophilus1 Cas9-NLS, and St1Cas9 gRNA
UseCRISPRTagsNLSExpressionBacterialPromoterT7 (x2)Available SinceJune 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
Non-specific sgRNA
Plasmid#109432PurposeMLM3636 backbone containing a gRNA that does not bind to any sequence in the human genome.DepositorInsertNon-specific gRNA
UseCRISPRExpressionMammalianPromoterhU6Available SinceJuly 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
PXL
Plasmid#75349PurposePX330 derived. Bbs1 & annealed oligos to insert guide strand. BstB1+Pac1 of PXL and FUX-/pRubiX- T2A-Cas9 for choice of sgRNA, viral backbone, and fluorescent protein. Pac1 to introduce 2nd sgRNA.DepositorInsertCas9
UseCRISPRExpressionMammalianPromoterU6Available SinceMay 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSP977
Plasmid#65774PurposeHuman expression vector for SpCas9 D1135E variant: CMV-T7-humanSpCas9(D1135E)-NLS-3xFLAGDepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9 (D1135E)-NLS-3XFlag
UseCRISPRTags3x FLAG and NLSExpressionMammalianMutationD1135E mutation in Cas9PromoterCMV & T7Available SinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMpGE006
Plasmid#108722PurposeCas9 expression in M.polymorphaDepositorInsertAtco-Cas9-Pea3ter
UseCRISPRExpressionPlantPromoterMpEFproAvailable SinceJune 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag3-gRNA3
Plasmid#196254PurposePlasmid for cloning the third CRISPR-Cas9 guide RNA of 4 guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag2-gRNA2
Plasmid#196252PurposePlasmid for cloning the second CRISPR-Cas9 guide RNA of multiplex guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag1-gRNA1
Plasmid#196251PurposePlasmid for cloning the first CRISPR-Cas9 guide RNA of multiplex guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag4-gRNA4
Plasmid#196255PurposePlasmid for cloning the 4th CRISPR-Cas9 guide RNA of 4 guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
M-ST1-VPR
Plasmid#68498Purposenuclease competent ST1-Cas9 fused to VPRDepositorInsertST-Cas9-VPR
TagsVPRExpressionMammalianPromoterCMVAvailable SinceSept. 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
SpRY-IP
Plasmid#235994PurposeExpresses Cas9-SpRY in mammalian cellsDepositorInsertSpRY
UseCRISPRExpressionMammalianPromoterEF-1aAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only