We narrowed to 1,304 results for: EYFP
-
Plasmid#201131PurposepLEX_307 plasmid with N-terminal EYFP tag and blasticidin markerDepositorTypeEmpty backboneUseTagsEYFPExpressionMammalianMutationPromoterEF-1αAvailable sinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-hSyn-STChRger2-TS-EYFP
Plasmid#129395PurposeSoma Targeted, High photocurrent, low-light sensitive channelrhodopsin (ChRger2) for optogenetic activation with systemic delivery or for low-light activation. Driven by human Synapsin I promoter.DepositorInsertsoma targeted ChRger2
UseAAVTagsKv2.1-TS-EYFPExpressionMammalianMutationPromoterhSynAvailable sinceOct. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-eYFP-f
Plasmid#104057PurposeAn AAV genome with tet-inducible, Cre-dependent expression of the fluorescent protein eYFP with a C-terminal Hras farnesylation sequenceDepositorInsertEYFP-f
UseAAVTagsExpressionMutationPromoterTREAvailable sinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLIX403-EYFP-ccdB-G418
Plasmid#158550PurposeSet of empty Gateway Cloning compatible, inducible, lentiviral vectors with various mammalian selection markers and N-terminal fluorescent protein fusionsDepositorTypeEmpty backboneUseLentiviralTagsEYFPExpressionMammalianMutationPromoterAvailable sinceAug. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVTagsExpressionMammalianMutationPromoterCAGAvailable sinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJM502 ZF1x6-C EYFP in TUPV1
Plasmid#161527PurposeInducible expression of EYFP under the ZF1x6-C promoterDepositorInsertEYFP
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterZF1x6-CAvailable sinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti/TO/EYFP-P2A-IDH1(HA)
Plasmid#122482PurposeA lentiviral vector (pLenti6.3/TO/DEST) expresses EYFP, P2A, and IDH1 C-terminally tagged with HADepositorInsertisocitrate dehydrogenase 1 (IDH1 Human)
UseLentiviralTagsHA and P2AExpressionMammalianMutationPromoterCMV/TOAvailable sinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVTagsExpressionMammalianMutationPromoterCAGAvailable sinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJM587 ZF10x6-C EYFP in TUPV2
Plasmid#161530PurposeInducible expression of EYFP under the ZF10x6-C promoterDepositorInsertEYFP
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterZF10x6-CAvailable sinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_WW-PolyA
Plasmid#112290PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) WW mutant. WQDP (199-202) in the first WW domain was changed to AQDA, and the WLDP (258-261) of the second WW domain was changed to ALDADepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralTagsExpressionMutationHuman YAP1-2gamma with mutations in the WW domain…PromoterEF-1 alphaAvailable sinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-Pds1Δdestruction box(383)
Plasmid#39848DepositorInsertPds1 (PTTG1 Human)
UseTagsEYFPExpressionMammalianMutationΔdestruction box = ΔR61-N68PromoterAvailable sinceOct. 31, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CaMKIIa.ChETA(E123T/H134R)-eYFP.WPRE.hGH
Plasmid#100050PurposeAAV expression of humanized ChR2 with E123T/H134R mutations fused to EYFP driven by CaMKIIa promoter for optogenetic activationDepositorHas ServiceAAV9InserthChR2(E123T/H134R)
UseAAVTagsEYFPExpressionMammalianMutationhumanized, E123T/H134RPromoterCaMKIIaAvailable sinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_delta5C-PolyA
Plasmid#112289PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) delta5C mutant lacking the last five residues (FLTWL) in the PDZ binding domain at the N-terminus of the proteinDepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralTagsExpressionMutationHuman YAP1-2gamma lacking the last 5 Amino acids …PromoterEF-1 alphaAvailable sinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_Y3F-PolyA
Plasmid#112288PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) Y3F mutant _ tyrosines 341, 357 and 394 corresponding to tyrosines 391, 407 and 444 in this isoformDepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralTagsExpressionMutation3 Tyrosines (341, 357 and 394 corresponding to ty…PromoterEF-1 alphaAvailable sinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJM467 TRE3GV EYFP in TU3
Plasmid#139255PurposeTRE3GV promoter and EYFP in TUPV3DepositorInsertEYFP
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterTRE3GVAvailable sinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-ChRger3-TS-EYFP
Plasmid#127241PurposeHigh photocurrent, low-light sensitive channelrhodopsin (ChRger3) for optogenetic activation with systemic delivery or for low-light activation. Driven by the CamKIIa promoter.DepositorInsertChRger3-TS-EYFP
UseAAVTagsEYFP and SpyTagExpressionMammalianMutationPromoterCamKIIaAvailable sinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pmCherry2-CD86-mEYFP(Q69K)
Plasmid#190749PurposeExpression of CD86 double tagged with mCherry2 (N-term) and mEYFP(Q69K) (C-term) in mammalian cells.DepositorInsertCD86 (CD86 Human)
UseTagsmCherry2 and mEYFP(Q69K)ExpressionMammalianMutationPromoterCMVAvailable sinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET15b/EYFP-GgVcl 1-851
Plasmid#46264DepositorInsertVcl 1-851 (VCL Chicken)
UseTagsEYFP and HisExpressionBacterialMutationaa 1-851 (aka Vh) head domainPromoterT7Available sinceJuly 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLIX403-EYFP-ccdB-EBFP2
Plasmid#158553PurposeSet of empty Gateway Cloning compatible, inducible, lentiviral vectors with various mammalian selection markers and N-terminal fluorescent protein fusionsDepositorTypeEmpty backboneUseLentiviralTagsEYFPExpressionMammalianMutationPromoterAvailable sinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-sbGLuc-B7-EYFP
Plasmid#114110Purposefusion protein of Gaussia luciferase variant slow burn, B7 transmembrane region, and enhanced yellow fluorescent protein; control for bioluminescent optogeneticsDepositorInsertsGaussia luciferase, slow burn
B7 hinge region
Enhanced Yellow Fluorescent Protein
UseAAVTagsExpressionMammalianMutationPromoterAvailable sinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only