We narrowed to 1,322 results for: EYFP
-
Plasmid#31807DepositorAvailable SinceSept. 14, 2011AvailabilityAcademic Institutions and Nonprofits only
-
pVH233-Tier1-PmPGK1-eYFP
Plasmid#169522PurposeTier-1 vector encoding PmPGK1-driven eYFP expression (PmPGK1-eYFP-pA).DepositorInsertPPGK-driven enhanced yellow fluorescent protein
ExpressionMammalianPromoterPPGKAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBS-TRE-EYFP-WPRE
Plasmid#104104PurposeExpresses EYFP under the TRE promoter in mammalian cells.DepositorInsertEYFP
ExpressionMammalianPromoterTREAvailable SinceJune 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pT2-CMV/TetO2-EYFP-GW
Plasmid#153309PurposeTet-On YFP-tagged Gateway destination vector, to be used together with pT2-TetR-neoR transposon plasmidDepositorTypeEmpty backboneUseTransposonTagsYellow Fluorescent ProteinAvailable SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-)-C2C1-ErNaR-TS-EYFP-ES
Plasmid#209851PurposeExpression of human codon-optimized light-driven sodium pump ErNaR in mammalian cellsDepositorInsertlight-driven sodium pump ErNaR
TagsEYFPExpressionMammalianPromoterCMVAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
mEYFP-(L)-mCherry2-(L)-mEGFP-(L)-mApple
Plasmid#182862PurposeHetero-tetramer expression vectorDepositorInsertmEYFP-mCherry2-mEGFP-mApple
ExpressionMammalianAvailable SinceApril 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
plex_307-EYFP-ccdB-zeo
Plasmid#201129PurposepLEX_307 plasmid with N-terminal EYFP tag and zeo markerDepositorTypeEmpty backboneTagsEYFPExpressionMammalianPromoterEF-1αAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-eYFP-FKBP-MAD1-AA
Plasmid#114038PurposeChemical induction of MAD1 localisation to a specific site in the cell (by rapamycin & FRB)DepositorInsertHuman MAD1 (MAD1L1 Human)
TagseYFP-FKBP12ExpressionMammalianMutationMAD2 binding deficient MAD1 K541A/L543APromoterCMVAvailable SinceOct. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-eYFP-f
Plasmid#104057PurposeAn AAV genome with tet-inducible, Cre-dependent expression of the fluorescent protein eYFP with a C-terminal Hras farnesylation sequenceDepositorInsertEYFP-f
UseAAVPromoterTREAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
plex_307-EYFP-ccdB-blasticidin
Plasmid#201131PurposepLEX_307 plasmid with N-terminal EYFP tag and blasticidin markerDepositorTypeEmpty backboneTagsEYFPExpressionMammalianPromoterEF-1αAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR708-5p-TS
Plasmid#117381PurposeAn AAV genome containing miRNA target sequence (TS) 708-5p to reduce expression of the fluorescent protein eYFP in neuronsDepositorInsertEYFP + 3 copies of miR708: CCCAGCTAGATTGTAAGCTCCTT
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLIX403-EYFP-ccdB-G418
Plasmid#158550PurposeSet of empty Gateway Cloning compatible, inducible, lentiviral vectors with various mammalian selection markers and N-terminal fluorescent protein fusionsDepositorTypeEmpty backboneUseLentiviralTagsEYFPExpressionMammalianAvailable SinceAug. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti/TO/EYFP-P2A-IDH1(HA)
Plasmid#122482PurposeA lentiviral vector (pLenti6.3/TO/DEST) expresses EYFP, P2A, and IDH1 C-terminally tagged with HADepositorInsertisocitrate dehydrogenase 1 (IDH1 Human)
UseLentiviralTagsHA and P2AExpressionMammalianPromoterCMV/TOAvailable SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJM502 ZF1x6-C EYFP in TUPV1
Plasmid#161527PurposeInducible expression of EYFP under the ZF1x6-C promoterDepositorInsertEYFP
UseSynthetic BiologyExpressionMammalianPromoterZF1x6-CAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_WW-PolyA
Plasmid#112290PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) WW mutant. WQDP (199-202) in the first WW domain was changed to AQDA, and the WLDP (258-261) of the second WW domain was changed to ALDADepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralMutationHuman YAP1-2gamma with mutations in the WW domain…PromoterEF-1 alphaAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-Pds1Δdestruction box(383)
Plasmid#39848DepositorAvailable SinceOct. 31, 2012AvailabilityAcademic Institutions and Nonprofits only -
pJM587 ZF10x6-C EYFP in TUPV2
Plasmid#161530PurposeInducible expression of EYFP under the ZF10x6-C promoterDepositorInsertEYFP
UseSynthetic BiologyExpressionMammalianPromoterZF10x6-CAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_delta5C-PolyA
Plasmid#112289PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) delta5C mutant lacking the last five residues (FLTWL) in the PDZ binding domain at the N-terminus of the proteinDepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralMutationHuman YAP1-2gamma lacking the last 5 Amino acids …PromoterEF-1 alphaAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-EF-EYFP-YAP1_Y3F-PolyA
Plasmid#112288PurposeFluorescently labels human YAP1-2gamma isoform (504 aa) Y3F mutant _ tyrosines 341, 357 and 394 corresponding to tyrosines 391, 407 and 444 in this isoformDepositorInsertEYFP-YAP1 (YAP1 Human)
UseLentiviralMutation3 Tyrosines (341, 357 and 394 corresponding to ty…PromoterEF-1 alphaAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only