We narrowed to 33,602 results for: CMV
-
Plasmid#205272PurposeHuman expression vector for human codon optimized N-terminal NLS-tagged SpuFz1-D300RDepositorInsertSpuFz1
TagsHA, NLS(Makkerh)ExpressionMammalianMutationD300RAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV HA hRB delta CDK + S249
Plasmid#58908Purposemammalian expression of human Rb with all Ser/Thr Cdk acceptor sites removed and S249 restoredDepositorInsertRb (RB1 Human)
TagsHAExpressionMammalianMutationdelta CDK* with S249 restoredPromoterCMVAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pTS1026-Tier1-PhCMV-3xNLS-iRFP670
Plasmid#169532PurposeTier-1 vector encoding PhCMV-driven iRFP670 that is localized to the nucleus (PhCMV-3xNLS-iRFP670-pA).DepositorInsertPCMV-driven nucleus-localized far-red fluorescent protein iRFP670
ExpressionMammalianPromoterPhCMVAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-CMV-Flag-RIOK3-STOP_IDG-K
Plasmid#170576PurposeGateway destination clone of RIOK3 (human) tagged with N-terminal Flag for generating protein-proximity networks using proximity-dependent biotinylation proteomicsDepositorInsertFlag-RIOK3 (RIOK3 Human)
UseLentiviral; Gateway destinationTagsFlagExpressionMammalianPromoterCMVAvailable SinceJan. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
CMV-CRY2oligo-mcherry-ANXA11(R346C)
Plasmid#164206PurposeExpresses CRY2oligo-mcherry tagged ANXA11 R346C mutant under CMV promoterDepositorInsertANXA11 (ANXA11 Human)
TagsCRY2oligo-mcherryExpressionMammalianMutationR346CPromoterCMVAvailable SinceMay 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCT-CMV-UBE3BΔHECT-copGFP-Puro
Plasmid#107343PurposeExpresses UBE3B deletion of HECT domain fused to copGFP in mammalian cells.DepositorInsertUBE3B(ΔHECT)-copGFP (UBE3B Human)
UseLentiviralTagscopGFPExpressionMammalianMutationdeletion of HECT domain (757-end)PromoterCMVAvailable SinceJune 26, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCMV5 Flag p38 alpha(agf)
Plasmid#20787DepositorInsertpCMV5 Flag p38 alpha (agf) (Mapk14 Mouse)
TagsFlagExpressionMammalianMutationreplaced Thr180 and Tyr182 with Ala and Phe, resp…Available SinceApril 14, 2009AvailabilityAcademic Institutions and Nonprofits only -
-
p3xFLAG-CMV-RNF8-N-terminus(1-140)
Plasmid#64675Purposeexpresses only N terminus of RNF8, amino acids 1 to 140DepositorInsertRing finger protein 8 (RNF8 Human)
TagsFLAGExpressionMammalianMutationonly N terminus amino acids 1-140PromoterCMVAvailable SinceMay 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
Construct 7 - CMVp-Cas9-3xNLS-HSVpA
Plasmid#81247PurposeExpresses Cas9 fused to 3xNLS driven by CMV promoter. For mammalian cell expressionDepositorInsertCas9-3xNLS
UseSynthetic BiologyExpressionMammalianAvailable SinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-hAcrVA3-NLS(sv40) (BPK5077)
Plasmid#115140PurposeCMV-T7 promoter expression plasmid for human codon optimized AcrVA3 anti-CRISPR protein with C-terminal NLSDepositorInserthuman codon optimized AcrVA3 anti-CRISPR protein
TagsNLS(SV40)ExpressionMammalianAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-hAcrVA2-NLS(sv40) (AAS2283)
Plasmid#115138PurposeCMV-T7 promoter expression plasmid for human codon optimized AcrVA2 anti-CRISPR protein with C-terminal NLSDepositorInserthuman codon optimized AcrVA2 anti-CRISPR protein
TagsNLS(SV40)ExpressionMammalianAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
p7055 pHAGE-P-CMVt-N-HA-GAW-COPZ1
Plasmid#100145PurposeExpresses COPZ1DepositorAvailable SinceOct. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEXfrt-SaCas9-U6-sgNtsr1
Plasmid#159910PurposeMutagenesis of Ntsr1DepositorInsertNtsr1 (Ntsr1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpG-P2A-mScarlet (MNW006)
Plasmid#174136PurposeCMV and T7 promoter expression plasmid for human codon optimized SpG(D1135L/S1136W/G1218K/E1219Q/R1335Q/T1337R) with a c-terminal bi-partite NLS, 3x flag tag, and P2A-mScarletDepositorInserthuman codon optimized SpG with BPNLS-3xFLAG-P2A-mScarlet
UseIn vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-mScarletExpressionMammalianMutationSpG=D1135L/S1136W/G1218K/E1219Q/R1335Q/T1337RPromoterCMV and T7Available SinceSept. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
p3xFLAG-CMV TIP60 212-364
Plasmid#78795PurposeTo overexpress TIP60 212-364 in Mammalian CellsDepositorAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRC/CMV-TYK21054-5FF-VSV
Plasmid#139347PurposeExpression of TYK2 protein mutated in the two tyrosines (Y1054F/Y1055F) of the activation loopDepositorInsertTYK2 cDNA with 267nt of 5' UTR (TYK2 Human)
ExpressionMammalianMutationV362F-Y1054F-Y1055FPromoterCMVAvailable SinceJune 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
-
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only