We narrowed to 8,504 results for: aav
-
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α-DIO-GtACR2-P2A-Voltron2ST-W3SL
Plasmid#217676PurposeAAV-mediated, Cre-dependent co-expression of GtACR2 and soma-targeted Voltron2 (ORCHID) for assessing inhibitory receptor driving force through voltage imaging with concurrent activation of GtACR2.DepositorHas ServiceAAV1InsertGtACR2-P2A-Voltron2ST
UseAAVTagsSoma targeting sequence (Kv2.1) on Voltron2 gene …ExpressionMammalianPromoterEF‐1αAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP2107 - pAAV-AiE2664m-minBG-SYFP2-WPRE3-BGHpA
Plasmid#230553PurposeAiE2664m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-Flex-DN-AMPK-K45R-T2A-mCherry
Plasmid#83491Purposecre-dependent DN-AMPK under EF1a promoterDepositorInsertDN-AMPK-2A-mCherry
UseAAV and Cre/LoxExpressionMammalianMutationK45RAvailable SinceOct. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Con/Fon-Arch3.3-p2a-EYFP
Plasmid#137148PurposeIntersectional viral expression of Arch3.3-EYFP in cells expressing both Cre AND FlpDepositorHas ServiceAAV8InsertCon/Fon-Arch3.3-p2a-EYFP
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationn/aPromoternEFAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-ADAR2-2a-Fezf2 sesRNA-2a-tTA2-WPRE
Plasmid#239027PurposeExpression of ADAR2, sesRNA in mammalian cells with hSyn promoter, with tTA2 as efRNA and ADAR2 overexpression.DepositorAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Camk2a(0.4)-DIO-Opto-cytTrkB(E281A)-HA
Plasmid#180588PurposeOpto-cytTrkBDepositorInsertTrkB
UseAAVMutationPHR(E281A)Available SinceFeb. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO-ChRmine-eYFP-Kv2.1-WPRE
Plasmid#130997PurposeDouble floxed soma-targeted ChRmine-eYFP under the control of Ef1a promoterDepositorInsertChRmine
UseAAVTagsEYFP-Kv2.1PromoterEf1aAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
p226-AAV-dlx-dio-mScarlet-T2A-SYPEGFP
Plasmid#185696PurposeAAV vector expressing cre-dependent mem-mScarlet, T2A, Synaptophysin-EGFP driven by Dlx promoterDepositorInsertmScarlet, T2A, Synaptophysin-EGFP
UseAAV and Cre/LoxTagsmScarlet palmitoylation, Synaptophysin fused to E…ExpressionMammalianPromotermDlxAvailable SinceJuly 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
AiP1788 - pAAV-AiE2116m-minBG-iCre(R297T)-BGHpA
Plasmid#220713PurposeAiE2116m is an enhancer sequence, designed to induce cre-dependent recombination in specific populations of brain cellsDepositorInsertiCre(R297T)
UseAAVPromoterminBGAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
AiP1047-pAAV-mscRE16-minBGpromoter-iCre-WPRE-hGHpA
Plasmid#163479PurposeDirect-expressing iCre AAV Virus. Alias: AiP1047 - pAAV-AiE2016m-minBG-iCre-WPRE-HGHpADepositorInsertiCre
UseAAVPromoterBeta Globin minimal promoterAvailable SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Con/Foff 2.0-ChR2-EYFP
Plasmid#137163PurposeIntersectional viral expression of ChR2-EYFP in cells expressing Cre AND NOT FlpDepositorHas ServiceAAV8InsertCon/Foff 2.0-ChR2-EYFP
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationH134RPromoternEFAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
AiP1733 - pAAV-AiE2389m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214532PurposeAiE2389m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1731 - pAAV-AiE2386m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214531PurposeAiE2386m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP995-pAAV-mscRE10-minBGpromoter-EGFP-WPRE-hGHpA
Plasmid#163485PurposeDirect-expressing EGFP AAV Virus. Alias: AiP995 - pAAV-AiE2010m-minBG-EGFP-WPRE-HGHpADepositorInsertEGFP
UseAAVPromoterBeta Globin minimal promoterAvailable SinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-AIO-M11-gRNA-EFS-NMS-SadCas9
Plasmid#210710PurposeThis Plasmid express M11 promoter driven SadCas9 specific gRNA and EFS promoter driven NMS transactivation module fused to SadCas9DepositorInsertSadCas9 specific gRNA and NMS fused to N-terminus of SadCas9
UseAAV and CRISPRTagsFLAGExpressionMammalianMutationD10A/N580APromoterM11Available SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
AiP1492 - pAAV-AiE2004m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214501PurposeAiE2004m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1332 - pAAV-AiE2114m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214483PurposeAiE2114m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-jGCamp7b-P2A-GSG-mRuby3
Plasmid#130900Purposebicistronic plasmid for dual-color neuronal calcium and morphology imagingDepositorInsertjGCaMP7b-P2A-mRuby3
UseAAVExpressionMammalianPromoterhSynAvailable SinceSept. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC468 - pAAV EF1a DIO hChR2(H134R)-iRFP
Plasmid#47633PurposeAn AAV vector that expresses channel rhodopsin 2 (H134R) (fused to iRFP) in a Cre-dependent manner (DIO, double floxed inverted open reading frame).DepositorInserthChR2 (H134R)
UseAAV and Cre/LoxTagsiRFPExpressionMammalianMutationH134RPromoterEF1aAvailable SinceSept. 12, 2013AvailabilityAcademic Institutions and Nonprofits only