We narrowed to 4,836 results for: HRE
-
Plasmid#146138PurposeInsect Expression of DmTral_394-543DepositorInsertDmTral_394-543 (tral Fly)
ExpressionInsectMutationthree silent mutations A198C, A387G, A1437G and 4…Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmTral_394-652_D
Plasmid#146139PurposeInsect Expression of DmTral_394-652DepositorInsertDmTral_394-652 (tral Fly)
ExpressionInsectMutationthree silent mutations A198C, A387G, A1437G and 4…Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmTral-R21EE23K_C
Plasmid#146078PurposeInsect Expression of DmTral-R21EE23KDepositorInsertDmTral-R21EE23K (tral Fly)
ExpressionInsectMutationthree silent mutations A198C, A387G, A1437G and 4…Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmTral-R21ES13AI15A_C
Plasmid#146079PurposeInsect Expression of DmTral-R21ES13AI15ADepositorInsertDmTral-R21ES13AI15A (tral Fly)
ExpressionInsectMutationthree silent mutations A198C, A387G, A1437G and 4…Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmTral-R42EF44A_C
Plasmid#146080PurposeInsect Expression of DmTral-R42EF44ADepositorInsertDmTral-R42EF44A (tral Fly)
ExpressionInsectMutationthree silent mutations A198C, A387G, A1437G and 4…Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmTral-S13AI15A_C
Plasmid#146081PurposeInsect Expression of DmTral-S13AI15ADepositorInsertDmTral-S13AI15A (tral Fly)
ExpressionInsectMutationthree silent mutations A198C, A387G, A1437G and 4…Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmTral-FDF-ADA_C
Plasmid#146039PurposeInsect Expression of DmTral-FDF-ADADepositorInsertDmTral-FDF-ADA (tral Fly)
ExpressionInsectMutationFDF to ADA (407-409) mutation. Additionally, thre…Available SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
GFP-Tac-STC(5A)
Plasmid#162491PurposeExpresses non-O-glycosylated partial length Tac (stem region, TMD and cytosolic tail) with GFP tag in mammalian cellsDepositorInsertpartial length Tac (stem region with mutations, TMD and cytosolic tail) (IL2RA Human)
TagsGFPExpressionMammalianMutationTac is in partial length with its stem region, TM…Available SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pQE30-VRN1-R249E-R289E-R296E
Plasmid#159532PurposeExpresses Arabidopsis thaliana VERNALIZATION1 mutant, with R249E, R289E and R296E mutations, in E. coliDepositorInsertVERNALIZATION1 (VRN1 Mustard Weed)
TagsSix-Histidine tagExpressionBacterialMutationThree charge reversal mutations, namely R249E R28…PromoterT5Available SinceDec. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
289aa ELL2
Plasmid#127266PurposeFor in vitro translation of shorter human ELL2 from Met1. Also contains Met133I, M1381I, M186I mutations.DepositorInsertNH2-ELL2 (Met133ILeu, M1381ILeu, M186ILeu) (ELL2 Human)
UseIn vitro translationMutationThree Mets (133, 138, 186) to Ileu. Contains 289…PromoterT7Available SinceJuly 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJC20cdc8.A18T
Plasmid#99360PurposeBacterial expression vector containing cDNA encoding for the fission yeast tropomyosin, Cdc8 with the amino acid substitution Ala-18-Thr.DepositorAvailable SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJC20cdc8.110
Plasmid#99363PurposeBacterial expression vector containing cDNA encoding for the temperature sensitive fission yeast tropomyosin mutant, Cdc8.110.DepositorInsertcdc8 (cdc8 Fission Yeast)
ExpressionBacterialMutationAlanine 18 to Threonine and Glutamic acid 31 to L…PromoterT7Available SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTH731-2µ-RLuc/minCFLuc
Plasmid#40601DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3Available SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pGL4-AARE-luc2P-Hygro
Plasmid#101787PurposeLuferase reporter plasmid containing three tandem repeats of the amino acid response element (AARE)DepositorInsert3xAARE
UseLuciferaseTagsLuciferaseExpressionMammalianPromoterminimal TATA-box promoter with low basal activityAvailable SinceSept. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL G44S (siRNA resistant)
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationG44SAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationE167DAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Tet-MKK6(DD)-Puro
Plasmid#86094PurposeTet/Dox inducible (TetR) constitutively active mutant MKK6/MAP2K6 in lentiviral vectorDepositorInsertMKK6 (MAP2K6 Human)
UseLentiviralTagsMyc tagExpressionMammalianMutationSerine 207 and Threonine 211 both changed to Aspa…PromoterCMV/TetOAvailable SinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMG071 MBP-GSK3β_S9A-HA-His, GST_λPPase
Plasmid#196185PurposeCo-expresses MBP-GSK3β_S9A-HA-His (human GSK3β with S9A mutation as a fusion protein with MBP, HA, and His-tags) and GST_λPPase in E.coli to produce unphosphorylated MBP-GSK3β_S9A-HA-HisDepositorInsertsTagsGST, HA, His6, and MBPExpressionBacterialMutationchanged Serine 9 to AlaninePromoterTacAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBridge-tyrosinase.σ1A
Plasmid#197381PurposeExpression of 1) GAL4 DNA-binding domain (BD)-tyrosinase cytosolic tail fusion protein, 2) HA epitope and nuclear localization signal (NLS) AP-1 σ1A fusion protein in yeast (yeast three-hybrid assays)DepositorInsertstyrosinase cytosolic tail
AP-1 σ1A
TagsGAL4-DNA binding domain fragment, HA tag, and SV4…ExpressionYeastMutationContains an extra 42 nucleotides encoding 14 resi…PromoterADH1 and MET25Available SinceMarch 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTH734-2µ-RLuc/stopCFLuc
Plasmid#40609DepositorInsertsFirefly Luciferase (nonsense mutant)
Renilla luciferase
ExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3Available SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only