We narrowed to 62,289 results for: ide
-
Plasmid#71295PurposeEncodes (N to C): GASTM mutated glycosylation motif, 3 residue spacer, RVG peptide,10 residue spacer, Lamp2b (exosomal membrane protein), 3 residue spacer, HA tag.DepositorInsertLamp2b (LAMP2 Human)
TagsGASTM mutated glycosylation motif, HA, Lamp2 sig…ExpressionMammalianPromoterCMVAvailable SinceDec. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
FCM101
Plasmid#194298PurposeE. coli expression vector for monobody adaptor, FCM101, that bind to the Fc region of mouse IgG1 subclass. It contains a single Cys residue at the C-terminus for chemical conjugation, N-terminal His6DepositorInsertFCM101
TagsHis tag, FLAG tagExpressionBacterialPromoterT7Available SinceMarch 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p35S_EVDm1
Plasmid#167121PurposePlant binary expression vector containing the coding sequence of the Arabidopsis Copia93 retroelement EVADE (AT5G17125) with U1 binding site mutated under CaMV 35S promoter.DepositorInsertEVADE (EVD) (AT5G17125 Mustard Weed)
ExpressionPlantMutationmutated four nucleotides at the snoRNA U1 binding…PromoterCaMV 35SAvailable SinceMay 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25K3
Plasmid#122242PurposeExpresses a dominant negative Kash construct that disrupts LINC complexes in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianPromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2 puro - CRBN (#1)
Plasmid#166240PurposesgRNA (#1) to generate a knockout of human CRBN by targeting the middle region of Exon1DepositorAvailable SinceDec. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2 puro - CRBN (#2)
Plasmid#166241PurposesgRNA (#2) to generate a knockout of human CRBN by targeting the start region of Exon1DepositorAvailable SinceDec. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pInducer-FRA1
Plasmid#192267PurposeDoxycycline-inducible expression of murine FRA1 (Fosl1)DepositorAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-FRA1
Plasmid#188665PurposeExpresses murine FRA1 (Fosl1)DepositorAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG_huMcl-1.1
Plasmid#85530PurposeInducible expression of guide RNA (huMcl-1.1) with fluorescent GFP reporterDepositorAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCS2-mkgDUX4mal*leu*
Plasmid#21173DepositorInsertDUX4 (DUX4 Human)
ExpressionBacterial and MammalianMutationFirst point mutation at nucleotide 5114 (numberin…Available SinceAug. 28, 2009AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25K3
Plasmid#122242PurposeExpresses a dominant negative Kash construct that disrupts LINC complexes in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianPromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2 puro - CRBN (#1)
Plasmid#166240PurposesgRNA (#1) to generate a knockout of human CRBN by targeting the middle region of Exon1DepositorAvailable SinceDec. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2 puro - CRBN (#2)
Plasmid#166241PurposesgRNA (#2) to generate a knockout of human CRBN by targeting the start region of Exon1DepositorAvailable SinceDec. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pInducer-FRA1
Plasmid#192267PurposeDoxycycline-inducible expression of murine FRA1 (Fosl1)DepositorAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-FRA1
Plasmid#188665PurposeExpresses murine FRA1 (Fosl1)DepositorAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG_huMcl-1.1
Plasmid#85530PurposeInducible expression of guide RNA (huMcl-1.1) with fluorescent GFP reporterDepositorAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCS2-mkgDUX4mal*leu*
Plasmid#21173DepositorInsertDUX4 (DUX4 Human)
ExpressionBacterial and MammalianMutationFirst point mutation at nucleotide 5114 (numberin…Available SinceAug. 28, 2009AvailabilityAcademic Institutions and Nonprofits only