We narrowed to 31,312 results for: ple
-
Plasmid#140227PurposeHypoxia-inducible expression of leucine zipper with C terminal dCpf1 (Cas12a) 406-split half fused to miniVPR. Constitutive EFS-driven puromycin resistance.DepositorInsertzipper with dLbCpf1 (Cas12a) C terminal half (406) fused to miniVPR
UseLentiviralExpressionMammalianPromoterHRE (Hypoxia inducible)Available SinceApril 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHR-HNRNPA1C-mCh-Cry2WT
Plasmid#101226PurposehnRNPA1(186-320) fused to mCh-Cry2WTDepositorAvailable SinceFeb. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1.Gαi1-LgB91
Plasmid#134342PurposeNanoluc complementation assay. Expression of Gαi1 protein fused with the LgBiT(LgB)of the nanoluciferase inserted between residues 91 and 92 of Gαi1. Addition of the HA epitope at N terminus of Gαi1.DepositorAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
CAPTURE1-1_pLVX-EF1a-BirA-P2A-FB-dCas9-IRES-zsGreen1
Plasmid#138417PurposeCAPTURE1.1 vector containing BirA-V5-His, P2A, FB-dCas9, IRES and zsGreen1DepositorInsertsBirA
dCas9
UseLentiviralTagsFLAG, Avi-tag and V5, HisPromoterEF1aAvailable SinceJuly 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-sACt-mCherry-NES
Plasmid#138215PurposeEncodes residues 1-469 of rat soluble adenylyl cyclase (ADCY10) fused to mCherry; cytosol targeted.DepositorInsertsACt-mCherry-NES (Adcy10 Rat)
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianPromoterCMVAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-BCR-ABL-p190-FLAG
Plasmid#205620PurposeExpression of BCR-ABL oncogene in mammalian cellsDepositorInsertBCR-ABL oncogene, p190 isoform b3a2
TagsFLAGExpressionMammalianMutationT117M- Please see depositor commentsPromoterCMVAvailable SinceSept. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
LiOn-CAG∞GFP
Plasmid#154015PurposeVector based on the LiOn integration-coupled translational switch (Kumamoto et al bioRxiv 2019) expressing the fluorescent protein EGFP from a CAG promoter upon action of the piggyBac transposaseDepositorInsertEGFP
ExpressionMammalianPromoterCAGAvailable SinceNov. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-mCherry-IRES-Dre
Plasmid#55633PurposeExpresses Dre in Mammalian CellsDepositorInsertsmCherry
Dre
UseAAVExpressionMammalianPromoterEf1a and Ef1a/IRESAvailable SinceJuly 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJZC78
Plasmid#62339PurposesgRNA + 1x COM with COM-KRAB effector for mammalian cellsDepositorInsertssgRNA + 1x COM binding module
COM-KRAB
UseLentiviralTagsKRABExpressionMammalianMutationTargets sv40 promoter, sequence: CATACTTCTGCCTGCT…PromoterCMV and U6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHSN401
Plasmid#50588PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInserts3×FLAG-NLS-zCas9-NLS
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG and NLSMutationmaize codon optimizedPromoter2×35Sp and AtU6-26pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMT1-24X-NOG(AtUBI10)
Plasmid#202016PurposeT-DNA vector for expression of the two protein components of the MoonTag system (dCas9-24XGP41 and NbGP41P-sfGFP-VP64-GB1) under the control of the AtUBI10 promoter.DepositorInsertsdCas9-24XGP41
NbGP41P-sfGFP-VP64-GB1
TagsGB1 and sfGFPExpressionPlantPromoterAtUBI10Available SinceAug. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC-GFP-MCC
Plasmid#133307Purpose"Burdensome" GFP expressing plasmid carrying microcin-V bacteriocin for plasmid stabilisationDepositorInsertmicrocin-V bacteriocin cassette (cvaC E. coli)
UseSynthetic BiologyExpressionBacterialMutationN112D (please see depositors comments)Available SinceFeb. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGGD_MiniTurboID-YFP
Plasmid#222434PurposeGolden Gate / Green Gate module for adding MiniTurboID and YFP as C-terminus of target protein.DepositorInsertMiniTurboID (BirA mutant)
UseGolden gate / green gate compatible cloning vectorTagsLinker and YFPMutationaa1-63 deleted; Q65P, I87V, R118S, E140K, Q141R, …Available SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
HA-MBP-TEVpCS-ADGRE5 CTFdeltaTA-FLAG
Plasmid#217726PurposeMammalian expression of Adhesion G Protein-Coupled Receptor transmembrane domainsDepositorInsertADGRE5 (ADGRE5 Human)
TagsFLAG and HAExpressionMammalianMutationDeletion of residues 1-536Available SinceApril 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBUN411
Plasmid#50581PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses 3×FLAG-NLS-zCas9-NLS, gRNA scaffold for insertion of target sequence (OsU3 promoter), Bar resistanceDepositorInserts3×FLAG-NLS-zCas9-NLS
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG and NLSMutationmaize codon optimizedPromoterOsU3p and Ubi1pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSF3-Flag-FRB-Cbir_Myc-NBir-FKBP
Plasmid#90008PurposeSplit-BioID plasmid: Expresses C-terminally tagged FRB-CBir[257-321] and N-terminally tagged NBir[2-256]-FKBPDepositorInsertsNBirA*-linker-FKBP
FRB-linker-CBirA*
UseRetroviral; Flp/frtTagsFLAG and MycExpressionMammalianPromoterCMVAvailable SinceJuly 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCSN068
Plasmid#101749PurposeSingle copy yeast plasmid expressing Cpf1 from Francisella novicida U112 (FnCpf1), codon optimized for expression in Saccharomyces cerevisiae.DepositorInsertsCpf1 from Francisella novicida U112 (FnCpf1) codon optimized for expression in S. cerevisiae.
KanMX marker expression cassette.
UseCRISPRTagsSV40 NLSExpressionYeastPromoterHeterologous TEF1 promoter from A. gossypii. and …Available SinceJan. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
SID4x-dCas9-KRAB
Plasmid#106399PurposeExpresses catalytically inactive dCas9 with N-terminal fusion of Sin3a Interacting Domain (SID) and C-terminal fusion of repressive KRAB domainDepositorAvailable SinceApril 3, 2018AvailabilityAcademic Institutions and Nonprofits only