We narrowed to 6,902 results for: sas
-
Plasmid#61725PurposeExpression of mouse Ezh2 fused to monomeric streptavidin (N-terminus)DepositorInsertEnhancer of zeste homolog 2 (Ezh2 Mouse)
TagsmSA (monomeric streptavidin)ExpressionMammalianPromoterT-REx (CMV + 2xTetO2)Available SinceJan. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX-6P1-Ataxin3Q22-UIM*
Plasmid#22114DepositorAvailable SinceOct. 1, 2009AvailabilityAcademic Institutions and Nonprofits only -
DG SaCas9 puro V3
Plasmid#226960PurposeCBh-SaCas9-2A-Puro, and 2X hU6-sgRNA (Sa) with BbsI golden gate cloning backbone for dual gRNAs. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEBTetDBl-CLIP-CPAP
Plasmid#136865PurposeMammalian expression of the centrosomal protein CENPJ N-terminally fused to CLIP-tagDepositorInsertCLIP-CENPJ (CENPJ Synthetic, Human)
TagsFLAG-tag / His-tagExpressionMammalianPromoterCMV-TetO2Available SinceMarch 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEBTetD-SNAP-CPAP
Plasmid#136816PurposeMammalian expression of the centrosomal protein CENPJ N-terminally fused to SNAP-tagDepositorInsertSNAP-CENPJ (CENPJ Synthetic, Human)
TagsFLAG-tag / His-tagExpressionMammalianPromoterCMV-TetO2Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mDlx-GCaMP6f-Fishell-2 (AAV1)
Viral Prep#83899-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-mDlx-GCaMP6f-Fishell-2 (#83899). In addition to the viral particles, you will also receive purified pAAV-mDlx-GCaMP6f-Fishell-2 plasmid DNA. mDlx-driven expression of GCaMP6f. These AAV preparations are suitable purity for injection into animals.DepositorPromotermDlxAvailable SinceNov. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mDlx-GCaMP6f-Fishell-2 (AAV9)
Viral Prep#83899-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-mDlx-GCaMP6f-Fishell-2 (#83899). In addition to the viral particles, you will also receive purified pAAV-mDlx-GCaMP6f-Fishell-2 plasmid DNA. mDlx-driven expression of GCaMP6f. These AAV preparations are suitable purity for injection into animals.DepositorPromotermDlxAvailable SinceNov. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV phSyn1(S)-tdTomato-WPRE (AAV5)
Viral Prep#51506-AAV5PurposeReady-to-use AAV5 particles produced from AAV phSyn1(S)-tdTomato-WPRE (#51506). In addition to the viral particles, you will also receive purified AAV phSyn1(S)-tdTomato-WPRE plasmid DNA. hSyn-driven tdTomato expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterphSyn1TagstdTomatoAvailable SinceNov. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pONSY-Lifeact:mCherry
Plasmid#111876PurposeThis plasmid expresses mCherry fused to Lifeact peptide. It labels actin bundles and filopodia in Capsaspora. Codons have been optimised according to their usages in Capsaspora and C. fragrantissima.DepositorInsertLifeact fused to mCherry
UseCapsaspora owczarzakiTagsmCherryPromoterElongation Factor 1 alpha (EF1a) from CapsasporaAvailable SinceJune 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
ML21
Bacterial Strain#61914PurposeC43(DE3)-based E. coli amino acid auxotrophic host strains used for selective isotope labeling. hisG tyrA genes deleted.DepositorBacterial ResistanceNoneAvailable SinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJG01
Plasmid#213505Purposeexpresses TdTomato in Capsaspora owczarzakiDepositorInsertTdTomato
PromoterEF1Available SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJP118
Plasmid#176494PurposeExpresses Lifeact-mScarlet under control of the Capsaspora EF1 promoter and HygR under control of the Capsaspora actin promoterDepositorInsertLifeact peptide
UseCapsaspora owczarzaki expressionAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pONSY
Plasmid#111873Purpose"Capsaspora owczarzaki" expression vector (backbone) modified from the pCR2.1. It bears the promoter and terminator regions from the endogenous Elongation Factor 1 alpha (EF1a) gene (CAOG_07807).DepositorTypeEmpty backboneUseCapsaspora owczarzakiPromoterElongation Factor 1 alpha (EF1a) from CapsasporaAvailable SinceJuly 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
Mouse Chromatin Regulator Library
Pooled Library#200011PurposeKnockout library targeting a comprehensive set of mouse genes with annotated function as chromatin regulators.DepositorExpressionMammalianUseCRISPR and LentiviralAvailable SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
ER-NFAST
Plasmid#233596PurposeExpression of NFAST on the ER membraneDepositorInsertNFAST
ExpressionMammalianPromoterCMVAvailable SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pONSY-mCherry
Plasmid#111874PurposeThis plasmid expresses mCherry fluorescent protein under endogenous EF1a promoter. It can be used to transfect "Capsaspora owczarzaki" cells and visualize them by fluorescence microscopy.DepositorInsertmCherry
UseCapsaspora owczarzakiTagsmCherryPromoterElongation Factor 1 alpha (EF1a) from CapsasporaAvailable SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pONSY-Venus
Plasmid#111875PurposeThis plasmid expresses Venus fluorescent protein under endogenous EF1a promoter. It can be used to transfect "Capsaspora owczarzaki" cells and visualize them by fluorescence microscopy.DepositorInsertVenus
UseCapsaspora owczarzakiTagsVenusPromoterElongation Factor 1 alpha (EF1a) from CapsasporaAvailable SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
ER-frNFAST
Plasmid#233599PurposeExpression of frNFAST on the ER membraneDepositorInsertfrNFAST
ExpressionMammalianPromoterCMVAvailable SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only