We narrowed to 24,891 results for: promoter
-
Plasmid#193758PurposeExpresses E2-Crimson under the control of PANI2 synthetic promoter, ColE1 origin of replication, Ampicillin selectionDepositorInsertE2-Crimson
UseSynthetic BiologyExpressionBacterialPromoterPANI2 synthetic promoter carrying binding sites f…Available SinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
htpG2-GFP
Plasmid#109388PurposeGFP cassette under the control of the htpG2 sigma32-responsive promoter. Used to test burden-responsive behaviour of the wt genomic promoter. The plasmid has got ColE1 origin of replication and AmpR.DepositorInsertphtpG2-GFP
ExpressionBacterialAvailable SinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZmUbi-5'UTR
Plasmid#154057PurposeLevel 0 Golden Gate vector, containing the ZmUbi promoter and 5' UTR with Level 0.5-compatible overhangs (Wheat construct)DepositorInsertPromoter and 5' UTR Ubiquitin (Zea mays)
UseSynthetic BiologyExpressionBacterialPromoterN/AAvailable SinceSept. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHes1-GFP (CC#109)
Plasmid#15133DepositorAvailable SinceJune 8, 2007AvailabilityAcademic Institutions and Nonprofits only -
pRK-flag-USP19 C506S
Plasmid#78584PurposeExpression flag-USP19 C506S in mammalian cellsDepositorInsertflag-USP19 C506S (USP19 Human)
TagsflagExpressionMammalianMutationmutate 506 cysteine residue to serinePromoterCMVAvailable SinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-E1.1-RFP
Plasmid#22928DepositorInsertE1.1 binding site from Scardigli et al., 2003 with minimal CMV
UseAAVExpressionMammalianAvailable SinceMay 25, 2010AvailabilityAcademic Institutions and Nonprofits only -
pGEX-p53 R175H
Plasmid#39480DepositorAvailable SinceSept. 25, 2012AvailabilityAcademic Institutions and Nonprofits only -
NK73
Plasmid#176609PurposeTo test bead engulfment of macrophages.DepositorAvailable SinceMay 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pXPR_212
Plasmid#133457PurposeU6 promoter expresses customizable Spyo-guide; EFS promoter expresses SaurCas9 and 2A site provides puromycin resistanceDepositorInsertcontrol guide
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAG-nucGFP11-3xControlgRNA
Plasmid#224568PurposeUbiquitous expression plasmid, CAG promoter (CMV immediate early enhancer and chicken beta actin promoter), three Control gRNAs with ribozyme self-cleavage sites, and nuclear split GFP(11) reporter.DepositorInsertGFP11-H2B
UseCRISPRTagsHistone H2B (nuclear localization)MutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEX-p53
Plasmid#39479DepositorAvailable SinceSept. 25, 2012AvailabilityAcademic Institutions and Nonprofits only -
pXPR_213
Plasmid#133456PurposeH1 promoter expresses customizable Saur-guide; EF1a promoter expresses SpyoCas9 and 2A site provides blasticidin resistanceDepositorInsertControl guide
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC-hU6-crScaffold_SV40-BFP
Plasmid#224860PurposecrRNA scaffold for RfxCas13d expressed from hU6 promoter and reporter BFP protein expressed from SV40 promoterDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionMammalianPromoterhU6Available SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1 beta-catenin Y654E
Plasmid#16073DepositorAvailable SinceNov. 2, 2007AvailabilityAcademic Institutions and Nonprofits only -
pEBG-TFII-I delta isoform
Plasmid#22188DepositorAvailable SinceNov. 13, 2009AvailabilityAcademic Institutions and Nonprofits only -
MBD1v1 pcDNA3.1
Plasmid#78140PurposeMammalian expression of MBD1v1DepositorAvailable SinceMay 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
USP19 sgRNA2
Plasmid#78586Purposedelete USP19 gene in human cellDepositorAvailable SinceJune 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLPP3
Plasmid#209965PurposeContains Level 0 Part: constitutive Promoter (P25) for the construction of Level 1 plasmidsDepositorInsertPromoter (P25)
ExpressionBacterialAvailable SinceSept. 13, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLPP7
Plasmid#209969PurposeContains Level 0 Part: autoinducible Promoter (PfabZ) for the construction of Level 1 plasmidsDepositorInsertPromoter (P_fabZ)
ExpressionBacterialAvailable SinceSept. 13, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits