We narrowed to 6,999 results for: crispr cas9 plasmids
-
Plasmid#85450PurposeExpress SpCas9 in mammalian cellsDepositorHas ServiceAAV8InsertpRSV
UseAAVPromoterpRSVAvailable SinceJan. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site2 (RTW448)
Plasmid#160137PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #2DepositorInsertSpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLM-AMA18.0 dCas9-VPR
Plasmid#138945PurposeFungal AMA1 backbone plasmid with sp-dCas9 fused to VP64-p65-Rta (VPR); ribozymes based sgRNA transcription unit; Terbinafine and Phleomycin selection markersDepositorInsertp40S:sp_dCas9m4_2xNLS-VPR; HH-HDV sgRNA transcription unit, Terbinafine (ergA) and Phleomycin (ble) selection markers
UseCRISPR and Synthetic Biology; Ama1 autonomously r…TagsNLSPromoterp40S (AN0465) Aspergillus nidulansAvailable SinceJan. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-J23111
Plasmid#113149PurposePlasmid constitutively expressing dCas9 proteinDepositorInsertdCas9
ExpressionBacterialMutationD10A & H840AAvailable SinceJan. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EF1alpha-dCas9-10xGCN4_Hygro
Plasmid#192651Purpose3rd generation lenti vector encoding dCas9-10xGCN4 (Suntag) with 2A Hygro resistance markerDepositorInsertdCas9-10xGCN4
UseCRISPR and LentiviralExpressionMammalianMutationD10A and N863A in Cas9PromoterEF1aAvailable SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJUMP18-dCas9_O
Plasmid#127028PurposeBasic Part O- ORF; Catalytically dead mutant of the Cas9 from Streptococcus pyogenes.DepositorInsertPart dCas9_O
UseSynthetic BiologyExpressionBacterialMutationNoneAvailable SinceJuly 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOSIP-KH-RBS2-dCas9
Plasmid#182740PurposeIntegrative plasmid at the HK022 site in E. coli carrying dCas9 under the control of a Ptet promoterDepositorInsertdCas9
UseCRISPR; Integrative vectorPromoterPtetAvailable SinceMay 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCas9-EcRT-Z3-Kan
Plasmid#232096PurposeYeast CEN plasmid for estradiol-inducible expression of spCas9 and Ec86 reverse transcriptase.DepositorInsertZ3 promoter and Z3EV transcription factor
UseCRISPRExpressionYeastPromoterZ3Available SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiV_Cas9_puro
Plasmid#108100PurposeLentiviral expression plasmid of spCas9 with puromycin resistance geneDepositorInsertCas9
UseCRISPR and LentiviralTagsFLAGExpressionMammalianPromoterEFS promoterAvailable SinceJuly 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBBR1-P2-SpCas9
Plasmid#232354PurposeThe plasmid pBBR1-P2-SpCas9 employs pBBR1MCS-2 as the vector, with Cas9 protein derived from S. pyogenes and the stationary phase promoter P2 sourced from S. marcescens HBQA7.DepositorInsertsCas9
sacB
UseCRISPRPromoterpromoter P2 from S. marcescens HBQA7Available SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
1255_pAAV-U6-SA-BbsI-MluI-gRNA-CB-SACas9-HA-OLLAS-spA
Plasmid#109320PurposePlasmid for AAV SaCas9 Mammalian Expression with a BbsI cloning site for a gRNADepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianAvailable SinceJune 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX459V2.0-eSpCas9(1.1)+K810A+K855A
Plasmid#108299PurposepX459 V2.0 (Plasmid #62988) with the K810A, K848A, K855A, K1003A, and R1060A mutationsDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceMay 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDD162 (Peft-3::Cas9 + Empty sgRNA)
Plasmid#47549PurposeCas9 + sgRNA plasmid that can be modified to cleave any Cas9 target site in the C. elegans genome.DepositorInsertsCas9
Empty sgRNA
UseCRISPRTagsHA and NLSExpressionWormMutationCodon optimized and with synthetic introns for C.…PromoterU6 and eef-1A.1 (eft-3)Available SinceSept. 9, 2013AvailabilityAcademic Institutions and Nonprofits only -
pHiFi Cas9-2×sgRNA (empty, donor)
Plasmid#162277PurposeAll-in-one vector for CRISPR/Cas9-mediated homology-independent knock-in system. The plasmid contains BPNLS-HiFi Cas9-BPNLS and two sgRNA expression cassettes.DepositorInsertHiFi Cas9
UseCRISPRTagsBPNLS and FLAG tagExpressionMammalianMutationSpCas9 (R691A)Available SinceAug. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_NoFlag_hROSA26_Left
Plasmid#191442PurposeExpresses the hROSA26 left sgRNA in combination with FLAGless eSpCas9(1.1) to target the hRosa26 safe harbor locusDepositorInserthROSA26 sgRNA
UseCRISPRExpressionMammalianPromoterCBhAvailable SinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
SIN-cPPT-G1B3-spCas9-WPRE-miR124T
Plasmid#245071PurposeCRISPR Editing with SpCas9, with miRNA-124 target sequence to repress transgene expression in neuronsDepositorInsertCas9, miR124T site
UseLentiviralExpressionMammalianPromoterHuman G1B3 promoterAvailable SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX260-U6-DR-BB-DR-Cbh-NLS-hSpCas9-NLS-H1-shorttracr-PGK-puro
Plasmid#42229PurposeThis plasmid separately encodes a human codon-optimized SpCas9, a tracrRNA and customizable crRNA.DepositorArticleInserthumanized S. pyogenes Cas9
UseCRISPRTags3xFLAGExpressionMammalianAvailable SinceMarch 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSMVP-Cas9FL-P2A-turboGFP
Plasmid#80941PurposePlasmid that expresses Cas9FL in mammalian cells; co-expresses turboGFP.DepositorInsertCas9FL
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMCS-rybozyme-IRES-CAS9
Plasmid#64668PurposePlasmid encoding multiple cloning site, rybozyme and IRES-CAS9.DepositorInsertsCAS9
HDV ribozyme
UseCRISPRTagsFlag, Internal ribosome entry site, and guide RNA…ExpressionMammalianAvailable SinceDec. 18, 2015AvailabilityAcademic Institutions and Nonprofits only