We narrowed to 10,899 results for: ESP
-
Plasmid#67611Purposebacterial expression of GST-PRMT9 missing residues 21-350DepositorInsertPRMT9 (PRMT9 Human)
TagsGSTExpressionBacterialMutationtruncation mutant missing aa 21-350PromotertacAvailable SinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
Kif17 1-490 motor p201
Plasmid#44706DepositorAvailable SinceSept. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBGSA FPR1 H4 (haplotype 4)
Plasmid#66718PurposeConstitutive expression of FPR1 in mammalian cellsDepositorAvailable SinceJune 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
p3.2mar-Luc
Plasmid#63696Purpose3.2 kb marine armor plate enhancer driving Luciferase expressionDepositorInsert3.2 kb marine stickleback armor plate enhancer
TagsLuciferaseExpressionMammalianPromoterTATA boxAvailable SinceApril 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7 Lmo3.5 shRNA
Plasmid#59295PurposeshRNA to mouse Lmo3DepositorInsertLmo3.5 shRNA
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianPromotermouse U6Available SinceAug. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7 Lmo3.8 shRNA
Plasmid#59294PurposeshRNA to mouse Lmo3DepositorInsertLmo3.8 shRNA
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianPromotermouse U6Available SinceAug. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
psicheck-2-Phb
Plasmid#48162Purposecontains Renilla Luciferase gene preceded by an intact (ATG) upstream open reading frame elementDepositorInsert5" UTR of Phb (Phb Mouse)
UseLuciferaseAvailable SinceOct. 16, 2013AvailabilityAcademic Institutions and Nonprofits only -
psicheck-2-Slc25a15 mod
Plasmid#48161Purposecontains Renilla Luciferase gene preceded by a mutated (ATG --> TTG) upstream open reading from elementDepositorInsert5" UTR of Slc25a15
UseLuciferaseAvailable SinceOct. 16, 2013AvailabilityAcademic Institutions and Nonprofits only -
psicheck-2-Mrpl1
Plasmid#48166Purposecontains Renilla Luciferase gene preceded by an intact (ATG) upstream open reading frame elementDepositorInsert5" UTR of MRPL11 (Mrpl11 Mouse)
UseLuciferaseAvailable SinceSept. 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
psicheck-2-Slc25a15
Plasmid#48160Purposecontains Renilla Luciferase gene preceded by an intact (ATG) upstream open reading frame elementDepositorInsert5" UTR of Slc25a15
UseLuciferaseAvailable SinceSept. 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
DUSP6
Plasmid#27975DepositorAvailable SinceApril 8, 2011AvailabilityAcademic Institutions and Nonprofits only -
-
pJRH-1179 U6-reci Gag-Cas9 v2
Plasmid#201914PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and sgRNA (human U6 promoter. BsmBI cutsites for spacer insertion)DepositorInsertGag-Cas9 v2
ExpressionMammalianPromoterCAGAvailable SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1 DOX off blast POLE
Plasmid#241437PurposeExpresses DOX-suppressible POLEDepositorInsertPOLE (POLE Human)
Tags3xFLAGExpressionMammalianMutationSilent Mutations disrupt shRNA targeting sitesAvailable SinceJan. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-hpGRISZ-TM
Plasmid#248028PurposePlasmid for packing AAV for hpGRISZ (synaptic zinc sensor)DepositorInserthpGRISZ
UseAAVPromoterhSynAvailable SinceDec. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T3-GST-Tev
Plasmid#177142PurposeBacterial vector for expression of an N-terminal GST fusion of the Tev proteaseDepositorInsertTev
TagsGSTExpressionBacterialPromoterTacAvailable SinceDec. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1362 scFv entry plasmid
Plasmid#201912PurposeEntry vector for cloning single chain variable fragments displayed on the human CD8a hinge and transmembrane domain (CAG promoter)DepositorInsertStuffer sequence (drop out for scFv cloning) + CD8 hinge and transmembrane domain
ExpressionMammalianPromoterCAGAvailable SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pZR112_Lenti-SFFV-mCherry-2A-dCas9-VP64
Plasmid#180263PurposeLentiviral expression vector for dCas9-VP64 in mammalian cellsDepositorInsertdCas9
UseCRISPR and LentiviralExpressionMammalianMutationNuclease dead Cas9PromoterSFFVAvailable SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pZR071_SFFV-dCas9-mCherry-KRAB
Plasmid#180264PurposeLentiviral expression vector for dCas9-KRAB in mammalian cellsDepositorInsertdCas9
UseCRISPR and LentiviralTagsKRAB and mCherryExpressionMammalianMutationNuclease dead Cas9PromoterSFFVAvailable SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only