We narrowed to 5,488 results for: PID;
-
Plasmid#73436PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 1E4.DepositorInsertRepressor 1E4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceMarch 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-5F5
Plasmid#73432PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 5F5.DepositorInsertRepressor 5F5 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
si:ch211-221n23.1_R (OZ604)
Plasmid#35244DepositorInsertZinc finger array targeting si:ch211-221n23.1 (si:ch211-221n23.1 Zebrafish)
UseZebrafish targetingAvailable SinceMarch 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
si:ch211-221n23.1_L (OZ603)
Plasmid#35243DepositorInsertZinc finger array targeting si:ch211-221n23.1 (si:ch211-221n23.1 Zebrafish)
UseZebrafish targetingAvailable SinceMarch 5, 2012AvailabilityAcademic Institutions and Nonprofits only -
pET-TP1107(Q15TAG)
Plasmid#247462PurposeBacterial expression of anti-IgG VHH clone TP1107 with amber stop codon at Q15 for unnatural amino acid incorporationDepositorInsertTP1107 Q15TAG
TagsHis6 and TEV protease cleavage siteExpressionBacterialMutationOriginal Q15 codon (CAA) was modified to amber st…PromoterT7Available SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICE-EGFP-FLAG-PLIN3
Plasmid#161918PurposeExpresses human PLIN3 with a N-terminal GFP-FLAG tag. Confers Puromycin resistance. Inducible in T-REx cells.DepositorAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET21a(+)-HIV RT-6xHis-RBS-prot
Plasmid#159149Purposeexpresses His-tagged HIV reverse transcriptase and untagged HIV proteaseDepositorInsertsHuman immunodeficiency virus 1 (HIV-1) reverse transcriptase
Human immunodeficiency virus 1 (HIV-1) protease
TagsHisExpressionBacterialMutationHIV-1 group M/subtype B – BH10 strainAvailable SinceSept. 1, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-hSyn-GRAB_DA1h
Plasmid#113050Purposeexpress the genetically-encoded fluorescent dopamine(DA) sensor GRAB_DA1h in neuronsDepositorHas ServiceAAV Retrograde and AAV9InsertGPCR activation based DA sensor GRAB_DA1h (DRD2 Human)
UseAAVPromoterhSynAvailable SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pICE-EGFP-FLAG-PSMD2
Plasmid#161917PurposeExpresses human PSMD2 with a N-terminal GFP-FLAG tag. Confers Puromycin resistance. Inducible in T-REx cells.DepositorInsert26S proteasome non-ATPase regulatory subunit 2 (PSMD2 Human)
TagsGFP-FLAGExpressionMammalianPromoterCMVAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pETM6-G6-vioABE-4A6-vioC-3A2-vioD
Plasmid#73440PurposeViolacein pathway (vioABECD) in monocistronic configuration, transcriptionally driven by orthogonal T7-lac promoter variants G6 (vioABE), 4A6 (vioC), and 3A2 (vioD) for orthogonal flux redirection.DepositorInsertPG6-vioABE-P4A6-vioC-P3A2-vioD
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterPG6, P4A6, and P3A2 (orthogonal T7-lac variants)Available SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-JEDI-2P-WPRE
Plasmid#179464PurposeGenetically encoded voltage indicator (GEVI) JEDI-2P in AAV production vector for neuron -specific expression using the promoter hSynDepositorHas ServiceAAV9InsertJEDI-2P
UseAAVExpressionMammalianPromoterhSynAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
Spike Display_6P-D614G
Plasmid#172734PurposeExpression vector for SARS-CoV-2 (HexaPro-D614G) spike used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
Tags3X-FLAG; Strep-Tag II; HRV 3C cut site; PDGFR-B T…ExpressionMammalianMutationEctodomain only (AAs 1-1208); 682-685 (furin site…PromoterCMVAvailable SinceAug. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCag FlpO-2A-Cre EV
Plasmid#129419Purposeepisomal expression of FlpO and Cre recombinasesDepositorInsertFlpO-2A-Cre
UseCre/Lox and Unspecified; Episomal expression vect…ExpressionMammalianPromoterCMV/Chick β-actin (CAG)Available SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pIG-701pUC19-tNGFR-P2A-FOXP3
Plasmid#186114PurposeKnockin of truncated NGFR to target geneDepositorAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti NLuc398-hLGALS8 IRES hCALCOCO2-CLuc394
Plasmid#128387PurposeExpresses a split firefly luciferase reporter based on the full length, human Gal8 and CALCOCO2, which interact following endosomal disruptionDepositorUseLentiviral, Luciferase, and Synthetic BiologyTagsCLuc394 and NLuc398ExpressionMammalianPromoterEFS and IRESAvailable SinceJan. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHA TST 3C SMO EABR
Plasmid#234989PurposeFor production of Extracellular Vesicles (EVs), with the receptor Smoothened (Smo), Twin-Strep-tag (TST), and an HA tag at its N-terminus on their surfaceDepositorAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPICZc-HsACTB*-thymosinB-8His
Plasmid#111146PurposeExpresses human beta-actin fused with thymosin beta and a His tag.DepositorInsertACTB (ACTB Human)
UsePichia pastoris integrationTagsThymosin beta and a His-tagExpressionYeastPromoterAOX1Available SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5_miniTurbo-C12orf49
Plasmid#155111Purposetransfection plasmid for the exogneous expression of N-terminal miniTurbo-tagged C12orf49 for generation of FlpIn cell lines for BioIDDepositorInsertC12orf49 (SPRING1 Human)
TagsminiTurboExpressionMammalianPromoterCMV/TO inducible promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only