We narrowed to 1,708 results for: CAG promoter
-
Plasmid#146845PurposeInsect Expression of HsTNRC6A_1208-1709-F1359ADepositorInsertHsTNRC6A_1208-1709-F1359A (TNRC6A Human)
ExpressionInsectMutationone non silent mutation K1578E compared to the se…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-HsTNRC6A-F1359A_L
Plasmid#146846PurposeInsect Expression of HsTNRC6A-F1359ADepositorInsertHsTNRC6A-F1359A (TNRC6A Human)
ExpressionInsectMutationone non silent mutation K1578E compared to the se…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-lambdaN-HA-HsTNRC6A_1-1208-siRNAres_K
Plasmid#146741PurposeMammalian Expression of HsTNRC6A_1-1208-siRNAresDepositorInsertHsTNRC6A_1-1208-siRNAres (TNRC6A Human)
ExpressionMammalianMutation254-1962 truncated version of the sequence given …Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgFDX1-1
Plasmid#251679PurposegRNA to knock out FDX1 in mammalian cellsDepositorInsertFDX1 ferredoxin 1 (FDX1 Human)
UseCRISPR and LentiviralAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
CRISPRoff-mScarletI
Plasmid#217783PurposeExpresses CRISPRoff-mScarletI (DNMT3A-DNMT3L-XTEN80-dCas9-HA-2xNLS-mScarletI-KRAB) downstream of the CAG promoter for gene epigenetic silencingDepositorInsertCRISPRoff-mScarletI (DNMT3A-DNMT3L-dCas9-mScarletI-KRAB)
Tags2xNLS, DNMT3A-DNMT3L, HA, KRAB, and mScarletIExpressionMammalianPromoterCAGAvailable SinceApril 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Neo-GFP/V5-Foxa1
Plasmid#105507PurposeMSCV-driven retroviral Foxa1 expression (V5-tagged)DepositorAvailable SinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRosa26-GT
Plasmid#40025DepositorInsertsGFP
beta-globin intron
Neo
tdT-3Myc
diphteria toxin A
Tags3 Myc tagsExpressionMammalianMutationdeleted nucleotides after nucleotide 274, inserti…PromoterCAG (chicken beta globin promoter and CMV enhance…Available SinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pBT268_(pCA-ATG-intron-tTA2-iiTRE-tdT3Mycii)
Plasmid#36880DepositorInsertstTA2
tdT-3Myc
insulator
Tags3 Myc tagsExpressionMammalianMutationinsertion of a beta-globin intron with a loxP sit…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available SinceAug. 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
DHFR-mNeon-GluA1
Plasmid#173009PurposeFor light regulated release of GluA1 from the endoplasmic reticulum. Driven by synapsin promoter. Intracellular trafficking can be better visualized with mNeon.DepositorInsertDHFR-mNeon-GluA1
TagsDHFR and mNeonExpressionMammalianPromoterChicken beta actin (CAG)Available SinceAug. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRosa26-TG
Plasmid#40026DepositorInsertsT (ATG)
beta-globin intron
Neo
GFP
diphteria toxin A
ExpressionMammalianMutationdeleted nucleotides 1-274 and insertion of FRT, …PromoterCAG (chicken beta globin promoter and CMV enhance…Available SinceOct. 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCA-T-intron(Neo)-G(LNL)
Plasmid#36908DepositorInsertsT (i.e., ATG, start codon as a first exon)
GFP
beta-globin intron
Neo
ExpressionMammalianMutationdeleted nucleotides before nucleotide 275 and ins…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available SinceAug. 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCA-T-intron(Neo)-G(FLLFLNL)
Plasmid#40021DepositorInsertsT (ATG)
GFP
beta-globin intron
Neo
Mutationdeleted nucleotides 1-274 and insertion of FRT, …PromoterCAG (chicken beta globin promoter and CMV enhance…Available SinceOct. 12, 2012AvailabilityAcademic Institutions and Nonprofits only -
pBT250_(pCA-G-intron(Neo)-tTA2)
Plasmid#36876DepositorInsertsGFP
tTA2
beta-globin intron
Neo
ExpressionMammalianMutationdeleted nucleotides after nucleotide 274, inserti…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available SinceAug. 8, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCA-G-intron(Neo)-T(LNL)
Plasmid#36907DepositorInsertsGFP
tdTomato-3Myc
beta-globin intron
Neo
Tags3 Myc tagsExpressionMammalianMutationdeleted nucleotides after nucleotide 274, inserti…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available SinceAug. 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
pPD774 HBS CMV_min DsRE2 in TUPV1
Plasmid#253885PurposeComponents for Integration Vectors: mMoClo TUPV, with HBS(CMV_min) promoter and DsRE2DepositorInsertDsRE2
UseSynthetic BiologyExpressionMammalianPromoterHBS(CMV_min)Available SinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPD1284 HBS(Ben) mHIF1beta in TU3
Plasmid#253914PurposeComponents for Integration Vectors: mMoClo TUPV, with HBS(YB_TATA) promoter and mHIF1_ in the MCSDepositorInsertHBS(YB_TATA) mHIF1_
UseSynthetic BiologyExpressionMammalianPromoterHBS(YB_TATA)Available SinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPD1359 HBS(YBTATA) LumiScarlet in TU4
Plasmid#253911PurposeComponents for Integration Vectors: mMoClo TUPV, with HBS(YB_TATA) promoter and LumiScarlet in the MCSDepositorInsertHBS(YB_TATA) LumiScarlet
UseSynthetic BiologyTags3xFLAGExpressionMammalianPromoterHBS(YB_TATA)Available SinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPD1352 HBS(SV40) LumiScarlet
Plasmid#253907PurposeComponents for Integration Vectors: mMoClo TUPV, with HBS(SV40_min) promoter and LumiScarlet in the MCSDepositorInsertHBS(SV40_min) LumiScarlet
UseSynthetic BiologyTags3xFLAGExpressionMammalianPromoterHBS(SV40_min)Available SinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPD1271 HBS(Ben) mHIF1a in TU2
Plasmid#253912PurposeComponents for Integration Vectors: mMoClo TUPV, with HBS(YB_TATA) promoter and mHIF1_ in the MCSDepositorInsertHBS(YB_TATA) mHIF1_
UseSynthetic BiologyExpressionMammalianPromoterHBS(YB_TATA)Available SinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPD1272 HBS(Ben) mHIF2a in TU2
Plasmid#253913PurposeComponents for Integration Vectors: mMoClo TUPV, with HBS(YB_TATA) promoter and mHIF2_ in the MCSDepositorInsertHBS(YB_TATA) mHIF2_
UseSynthetic BiologyExpressionMammalianPromoterHBS(YB_TATA)Available SinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPD775 HBS YB_TATA DsRE2 in TUPV1
Plasmid#253886PurposeComponents for Integration Vectors: mMoClo TUPV, with HBS(YB_TATA) promoter and DsRE2DepositorInsertDsRE2
UseSynthetic BiologyExpressionMammalianPromoterHBS(YB_TATA)Available SinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPD1358 HBS(YBTATA) LumiScarlet in TU3
Plasmid#253910PurposeComponents for Integration Vectors: mMoClo TUPV, with HBS(YB_TATA) promoter and LumiScarlet in the MCSDepositorInsertHBS(YB_TATA) LumiScarlet
UseSynthetic BiologyTags3xFLAGExpressionMammalianPromoterHBS(YB_TATA)Available SinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPD1031 EF1a miRFP670 2A Blast
Plasmid#253904PurposeComponents for Integration Vectors: mMoClo TUPV, with EF1alpha promoter and miRFP720-P2A-BlastR in the MCSDepositorInsertmiRFP720-P2A-BlastR
UseSynthetic BiologyExpressionMammalianPromoterEF1alphaAvailable SinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPD1357 HBS(YBTATA) LumiScarlet in TU2
Plasmid#253909PurposeComponents for Integration Vectors: mMoClo TUPV, with HBS(YB_TATA) promoter and LumiScarlet in the MCSDepositorInsertHBS(YB_TATA) LumiScarlet
UseSynthetic BiologyTags3xFLAGExpressionMammalianPromoterHBS(YB_TATA)Available SinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPD1351 HBS(CMV) LumiScarlet
Plasmid#253906PurposeComponents for Integration Vectors: mMoClo TUPV, with HBS(CMV_min) promoter and LumiScarlet in the MCSDepositorInsertHBS(CMV_min) LumiScarlet
UseSynthetic BiologyTags3xFLAGExpressionMammalianPromoterHBS(CMV_min)Available SinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPD1350 HBS(YBTATA) LumiScarlet
Plasmid#253908PurposeComponents for Integration Vectors: mMoClo TUPV, with HBS(YB_TATA) promoter and LumiScarlet in the MCSDepositorInsertHBS(YB_TATA) LumiScarlet
UseSynthetic BiologyTags3xFLAGExpressionMammalianPromoterHBS(YB_TATA)Available SinceApril 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAC1809_pmax-RBM38-FRB
Plasmid#118642PurposeTransient transfection; Expresses RBM38-FRB; CAGGS promoterDepositorInsertRBM38-FRB
UseCRISPRExpressionMammalianPromoterCAGGSAvailable SinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAC1810_pmax-FRB-RBM38
Plasmid#118643PurposeTransient transfection; Expresses FRB-RBM38; CAGGS promoterDepositorInsertFRB-RBM38
UseCRISPRExpressionMammalianPromoterCAGGSAvailable SinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-EF1a-KRAB-dCas9-P2A-BlastR BFP-guide1
Plasmid#118157PurposeCRISPRi negative control. Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the EF1a core promoter, and sgRNA1 against the BFP CDSDepositorInsertKRAB-dCas9-P2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterEF1a core and U6Available SinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 (mPCSK9)
Plasmid#170122PurposeAAV vector carrying 2 copies of a guide RNA targeting the mouse PCSK9 mRNA, expressed from human and mouse U6 promotersDepositorInsertCircular 200,100 guide RNA (Pcsk9 Mouse)
UseAAVExpressionMammalianPromoterHuman U6 and mouse U6Available SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJET1.2-U6
Plasmid#173157PurposeSingle guide RNA cassette under U6 promoterDepositorInsertsgRNA cassette under U6 promoter
ExpressionPlantPromoterAtU6-26Available SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUC gRNA Shuttle
Plasmid#47024PurposeEncodes a template from which gRNAs can be made via InFusion cloning. The Medicago truncatula U6.6 promoter drives the gRNA. For use in plants.DepositorInsertgRNA Shuttle
UseCRISPR; Cas9ExpressionPlantMutationG to T cloning mutation at position 323PromoterMedicago truncatula U6.6Available SinceSept. 3, 2013AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSLQ1371-sgITGB1-1
Plasmid#121533PurposesgITGB1-1 sequence: GAAGCAGGGCCAAATTGTGGG. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgITGB1-1
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceNov. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G3_Dual_sgRNA
Plasmid#173202PurposeCoselection for PE3 or HDR in human cells. Vector for tandem expression of ATP1A1 G3 sgRNA with a user-specified PE3 nick sgRNA from two independent U6 promoters. Cloning of oligos using BbsI sites.DepositorInsertATP1A1 G3 sgRNA + user-specified sgRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_ATP1A1_G7_Dual_sgRNA
Plasmid#173206PurposeCoselection for HDR in human cells. Vector for dual expression of ATP1A1 G7 sgRNA in combination with a user-specified sgRNA from two independent U6 promoters. Cloning of oligos using BbsI sites.DepositorInsertATP1A1 G7 sgRNA + user-specified sgRNA + SpCas9
UseCRISPRExpressionMammalianPromoterDual U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_Dual_pegRNA
Plasmid#173199PurposeCoselection for prime editing in human cells. Vector for tandem expression of ATP1A1 Q118R-G4 pegRNA with a user-specified pegRNA from two independent U6 promoters. pU6-pegRNA-GG-acceptor-like plasmidDepositorInsertATP1A1 G4 Q118R pegRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgITGB4-3
Plasmid#121536PurposesgITGB4-3 sequence: GAGGAGCGTAGGTCCTCGCAG. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgITGB4-3
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceNov. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-Casp2-shRNA
Plasmid#157926PurposeKnockdown of caspase-2DepositorAvailable SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgITGB4-1
Plasmid#121535PurposesgITGB4-1 sequence: GAGGCGCAGTCCTTATCCACA. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgITGB4-1
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceNov. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330_ATP1A1_G3_Dual_sgRNA
Plasmid#173205PurposeCoselection for HDR in human cells. Vector for dual expression of ATP1A1 G3 sgRNA in combination with a user-specified sgRNA from two independent U6 promoters. Cloning of oligos using BbsI sites.DepositorInsertATP1A1 G3 sgRNA + user-specified sgRNA + SpCas9
UseCRISPRExpressionMammalianPromoterDual U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgITGB1-3
Plasmid#121534PurposesgITGB1-3 sequence: GTTCAGTGAATGGGAACAACG. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgITGB1-3
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceNov. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 (mIDUA)
Plasmid#170123PurposeAAV vector carrying 2 copies of a guide RNA targeting the mouse IDUA mRNA, expressed from human and mouse U6 promotersDepositorInsertCircular 200,100 guide RNA (Idua Mouse)
UseAAVExpressionMammalianPromoterHuman U6 and mouse U6Available SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pB-puro-mU6-CNPsgRNA
Plasmid#126610PurposeExpresses CNP sgRNA under mouse U6 promoterDepositorAvailable SinceJune 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-lambdaN-HA-HsTNRC6A-F1359A-siRNAres_K
Plasmid#146744PurposeMammalian Expression of HsTNRC6A-F1359A-siRNAresDepositorInsertHsTNRC6A-F1359A-siRNAres (TNRC6A Human)
ExpressionMammalianMutationone non silent mutation K1578E compared to the se…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC-hU6-crCoV-Mutiplex_EF1a-BFP
Plasmid#224788PurposeSARS-COV-2 targeting crRNA array for RfxCas13d expressed from single hU6 promoter and reporter BFP protein expressed from EF1a promoterDepositorInsertcrCoV20, crCoV21, crCoV24
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhU6 and hU6-2xTetOAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-lambdaN-HA-HsTNRC6A-del1352-1369-siRNAres_K
Plasmid#146743PurposeMammalian Expression of HsTNRC6A-del1352-1369-siRNAresDepositorInsertHsTNRC6A-del1352-1369-siRNAres (TNRC6A Human)
ExpressionMammalianMutationone non silent mutation K1578E compared to the se…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-lambdaN-HA-HsTNRC6A_1242-1709-F1359A_K
Plasmid#146742PurposeMammalian Expression of HsTNRC6A_1242-1709-F1359ADepositorInsertHsTNRC6A_1242-1709-F1359A (TNRC6A Human)
ExpressionMammalianMutationfive non silent mutations D1289G, G1515A, S1516G,…Available SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
OA-1050I (notch)
Plasmid#132421Purposeexpress arrays of gRNA targeting Notch under dU6-3 promoterDepositorInsertnotch gRNA array
ExpressionInsectPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
OA-1050U (cinnabar)
Plasmid#132423Purposeexpress arrays of gRNA targeting Cinnabar under dU6-3 promoterDepositorInsertcinnabar gRNA array
ExpressionInsectPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only