We narrowed to 25,285 results for: crispr
-
Plasmid#129463PurposeTemplate plasmid for guide sequence insertion via inverse PCR. Derived from pSCrhaB2-gRNA (see paper).DepositorInsertpgRNA
UseCRISPRExpressionBacterialPromoterBBa_J23119 (SpeI)Available sinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAc5 HA3-eDHFR-T2A-puro
Plasmid#86395Purposefor C-terminal tagging with eDHFR trimethoprim regulated degron with puro selectionDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertHA3 eDHFR T2A puro
UseCRISPRTagsHA3 eDHFR T2A puroMutationR12Y, G67S and Y100I mutations in E coli DHFRAvailable sinceMarch 9, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pET-6His-MBP-MpAgo
Plasmid#79249PurposeThis plasmid encodes the Argonaute protein from Marinitoga Piezophila and is codon optimized for E. coli expressionDepositorInsertMarinitoga piezophila Argonaute
UseCRISPRTags6XHis-tag + MBP + PreScission Cleavage SiteExpressionBacterialPromoterT7Available sinceJuly 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMK283 (Stag-3FLAG-Neo)
Plasmid#72799PurposeC-terminal tagging with Stag-3FLAG using CRIPSR/Cas9DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertStag-3FLAG-Neo
UseCRISPRTagsStag-3FLAGExpressionMammalianAvailable sinceMarch 24, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJM147
Plasmid#134167PurposeRetroviral plasmid expressing GFP - Nde1DepositorInsertNde1_SSSC E47A E. coli codon optimized (CRISPR/Cas9 hardened) (NDE1 Human)
UseRetroviralTagsGFPExpressionMammalianMutationSSSC E47A, E. coli codon optimized, CRISPR/Cas9 h…Available sinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
v3em-Cterm-PE6d-dualU6-Rosa26-twinPE-attB
Plasmid#207860PurposeAAV genome encoding C-terminal PE6d and U6 expression cassettes for Rosa26 twinPE pegRNA pairsDepositorInsertNpuC-Cterm-PE6d-dualU6-Rosa26-twinPE-attB
UseAAVMutationSee ManuscriptPromoterCbhAvailable sinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-T2A-Gal4-3xP3-RFP
Plasmid#127556PurposeCRISPaint universal donor plasmid for gene exon insertion. Encodes T2A-Gal4-SV40 and 3xP3-RFP visible eye marker.DepositorInsertGal4
UseCRISPRExpressionInsectAvailable sinceAug. 13, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
TLCV2-APOBEC1-YTH
Plasmid#178949PurposeLentiviral vector for dox-inducible expression of APOBEC1-YTH in mammalian cellsDepositorInsertAPOBEC1-YTH-T2A-GFP
UseLentiviral and Synthetic Biology; InducibleTagsHAExpressionMammalianPromotertight TREAvailable sinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
gRNA-CasRx_SD1-pSV40-TagBFP
Plasmid#221004PurposeTransiently express CasRx DR30 repeat with gRNA spacer. Contains SD1 mutation to enhance efficiency. SV40-TagBFP cassette to monitor transfection efficiency. Use BbsI with overhangs Fw-AAAC, Rv-AAAA.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCasRx 30nt processed direct repeat with SD1 mutation
UseCRISPRExpressionMammalianMutationDR1 A>TPromoterU6Available sinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
BLADE
Plasmid#134912PurposeEmpty backbone for cloning sgRNA sequence to be used in nanoblades systemDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyPromoterU6Available sinceDec. 10, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PCT62
Plasmid#170391Purposeexpresses three sgRNA cassettesDepositorInsertPCT62-targetsite
UseLentiviralExpressionMammalianPromoterEF1aAvailable sinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pACTA2_HL-P2A-eGFP-PGK-PuroR-ACTA2_HR
Plasmid#126705Purposedonor vector for targeting a 2A peptide followed by green fluorescent reporter to the human ACTA2 locus at the end of the endogenous coding sequenceDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertGFP
UseCRISPRAvailable sinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
plRL117
Plasmid#163635PurposeOptimized M. smegmatis CRISPRi plasmid; L5 integrating.DepositorTypeEmpty backboneUseCRISPRExpressionBacterialPromoterTet-OnAvailable sinceAug. 11, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMK277 (mClover-NeoR)
Plasmid#72793PurposeC-terminal tagging with mClover using CRIPSR/Cas9DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertmClover-Neo
UseCRISPRTagsmCloverExpressionMammalianAvailable sinceMarch 24, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pHAGE-EFS-PCP-3XNeon-nls
Plasmid#75386PurposePCP-3XNeon-nlsDepositorInsertPCP
UseLentiviralTags3XmNeonGreenExpressionMammalianPromoterEFSAvailable sinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT-GEM(1)
Plasmid#62893PurposeTrojan-Gal4 Expression Module in Phase 1. Insert T2A-Gal4 to genomic loci using the Crispr/Cas technology. Can be converted by cassette exchange into other Trojan exonsDepositorTypeEmpty backboneAvailable sinceMay 1, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pT-GEM(2)
Plasmid#62894PurposeTrojan-Gal4 Expression Module in Phase 2. Insert T2A-Gal4 to genomic loci using the Crispr/Cas technology. Can be converted by cassette exchange into other Trojan exonsDepositorTypeEmpty backboneAvailable sinceMay 1, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
VE-cad-eGFP Donor plasmid
Plasmid#92309PurposeKnock eGFP into human VE-cad locusDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertVEcad Homologous Recombination Arms (CDH5 Human)
UseCRISPRExpressionMammalianMutationabout 30 a.a. truncated at end of proteinAvailable sinceAug. 1, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMK284 (Stag-3FLAG-Hygro)
Plasmid#72800PurposeC-terminal tagging with Stag-3FLAG using CRIPSR/Cas9DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertStag-3FLAG-Hygro
UseCRISPRTagsStag-3FLAGExpressionMammalianAvailable sinceMarch 24, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by