We narrowed to 35,544 results for: IND
-
Plasmid#131381PurposeLow level expression of E.coli G.stearothermophillus MutY chimera protein with amino acid change F307Y in Gs MutY.DepositorInsertEcNGsC MutY chimera F307Y
ExpressionBacterialMutationFusion of two MutY genes. Residues 1-225 are from…PromotertacAvailable SinceJan. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
EcNGsC-F307A-pKK223
Plasmid#131382PurposeLow level expression of E.coli G.stearothermophillus MutY chimera protein with amino acid change F307A in Gs MutY.DepositorInsertEcNGsC MutY chimera F307A
ExpressionBacterialMutationFusion of two MutY genes. Residues 1-225 are from…PromotertacAvailable SinceJan. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
EcNGsC-S308V-pKK223
Plasmid#131393PurposeLow level expression of E.coli G.stearothermophillus MutY chimera protein with amino acid change S308V in Gs MutY.DepositorInsertEcNGsC MutY chimera S308V
ExpressionBacterialMutationFusion of two MutY genes. Residues 1-225 are fro…PromotertacAvailable SinceJan. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
EcNGsC-S308A-pKK223
Plasmid#131394PurposeLow level expression of E.coli G.stearothermophillus MutY chimera protein with amino acid change S308A in Gs MutY.DepositorInsertEcNGsC MutY chimera S308A
ExpressionBacterialMutationFusion of two MutY genes. Residues 1-225 are fro…PromotertacAvailable SinceJan. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
FLAG-SENP2 NPm
Plasmid#126593PurposeExpresses siRNA resistant SENP2 (nuclear pore mutant) in mammalian cells, Dox inducible in TetR cell linesDepositorInsertSENP2 (SENP2 Human)
TagsFLAGExpressionMammalianMutationDeletion of amino acids 1-65 and L329A/L331A in t…PromoterCMVAvailable SinceOct. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
FLAG-SENP2 CCm
Plasmid#126594PurposeExpresses siRNA resistant SENP2 (coiled-coil deletion) in mammalian cells, Dox inducible in TetR cell linesDepositorInsertSENP2 (SENP2 Human)
TagsFLAGExpressionMammalianMutationDeletion of amino acids 203-228 and siRNA resista…PromoterCMVAvailable SinceOct. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
EF1a-3NLS-Klf4 TALE-GCN4
Plasmid#120546PurposeExpress 3xNLS-Klf4 TALE-GCN4 engineered to bind a site in the human KLF4 geneDepositorAvailable SinceApril 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.2.mKO2
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCDX2 ObLiGaRe Donor vector/EPB64
Plasmid#90017PurposeDonor vector for ObLiGaRe/ZFN mediated targeting to CDX2 exon1 locusDepositorInsertMCS flanked by inverted CDX2 ZFN binding sites (CDX2 Human)
ExpressionBacterialAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLPC-NMYC-mTRF1deltaBLM
Plasmid#64163PurposeRetroviral vector expressing mouse TRF1 lacking BLM-binding motifs with N-terminal Myc tagDepositorInsertmTRF1 (Terf1 Mouse)
UseRetroviralTagsMycExpressionMammalianMutationDeleted amino acids 313-316 and 339-342 (both BLM…PromoterCMVAvailable SinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
HA-HIF1alpha P402A/P564A-pcDNA3
Plasmid#18955DepositorInsertHypoxia inducible factor 1 alpha (HIF1A Human)
TagsHA-tagExpressionMammalianMutationcDNA changed amino acids: Proline 402 to Alanin…Available SinceAug. 20, 2008AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1/Halo-CAAX
Plasmid#249173PurposeMammalian expression vector of CAAX motif (plasma membrane marker) fused with Halo-tagDepositorInsertCAAX (HRAS Human)
TagsHaloExpressionMammalianMutationOnly 10 amino acids ending with CVLS (CAAX motif)PromoterCMVAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
Villinpromoter-blue-FlpOERT2
Plasmid#67278Purpose4hydroxytamoxifen inducible FlpO recombinase controlled by intestine specific promoter (Villin). FlpO is linked to mTQ2 -a blue fluorescent protein. The gene cassette is in a SB transposon contextDepositorInsertVillin-mTQ2-P2A-FlpO-ERT2
TagsmTQ2, linked to FlpO through an P2A ribosomal ski…ExpressionMammalianPromoterVillinAvailable SinceJuly 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-GSX2
Plasmid#96964PurposeDox-inducible expression of Gsx2 in mammalian cellsDepositorInsertGSX2 (Gsx2 Mouse)
ExpressionMammalianAvailable SinceJuly 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBactin-mOrange2-NEDD1-gTBD
Plasmid#196858PurposeExpression of the gamma-tubulin-binding domain (gTBD) of NEDD1 fused to mOrange. Used to displace endogenous gamma-TuRC from the centrosome.DepositorInsertmOrange2-N-gTBD (NEDD1 Human)
ExpressionMammalianPromoterChicken bactin (plus Chicken bactin intron)Available SinceMay 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-CaBLAM
Plasmid#244129PurposeBioluminescent calcium indicatorDepositorInsertCaBLAM
ExpressionMammalianMutationCalmodulin N98IAvailable SinceFeb. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCS2+MLS-HyPer7
Plasmid#136470PurposeMammalian expression of mitochondrial matrix targeted ultrasensitive hydrogen peroxide indicator HyPer7 for optical imagingDepositorInsertHyPer7
TagsTandem mitochondrial targeting signal of cytochro…ExpressionMammalianPromoterCMV, SP6Available SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLIX403_RPS2_APOBEC_HA_P2A_mRuby_Capture1
Plasmid#194703PurposeInducible lentiviral expression, TRE-RPS2-APOBEC-HA-P2A-mRuby; PGK-puro-2A-rtTA (Ribo-STAMP, RPS2)DepositorInsertRPS2 (RPS2 Human)
UseLentiviralTagsAPOBEC1-HA-P2A-mRubyExpressionMammalianPromoterTRE promoter, Tet ONAvailable SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCS2+IMS-HyPer7
Plasmid#136469PurposeMammalian expression of mitochondrial intermembrane space targeted ultrasensitive hydrogen peroxide indicator HyPer7 for optical imagingDepositorInsertHyPer7
TagsSMAC/DIABLOExpressionMammalianPromoterCMV, SP6Available SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV-TetO-hNGN2-Puro
Plasmid#79049PurposeExpresses human NEUROGENIN2 (hNGN2) and puromycin resistance gene under control of TetON promoter. This lentiviral vector is used to generate NGN2-iNs (induced neurons) from hiPSCs and hiPSC-NPCs.DepositorAvailable SinceJuly 21, 2016AvailabilityAcademic Institutions and Nonprofits only