169,057 results
-
Plasmid#139988PurposeCMV and T7 promoter expression plasmid for human codon optimized SpG(D1135L/S1136W/G1218K/E1219Q/R1335Q/T1337R) with a c-terminal bi-partite NLS, 3x flag tag, and P2A-EGFPDepositorInserthuman codon optimized SpCas9 variant named SpG with BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationSpG=D1135L/S1136W/G1218K/E1219Q/R1335Q/T1337RPromoterCMV and T7Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCW empty vector
Plasmid#184708PurposeLentiviral empty vector for doxycycline-inducible expressionDepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
WT GBA pcDNA3.1
Plasmid#188580PurposeEctopic expression of wild-type GBADepositorAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-iGABASnFR2-WPRE
Plasmid#218874PurposeAAV-mediated expression of improved GABA sensor (positive change in fluorescence)DepositorHas ServiceAAV1 and AAV5InsertiGABASnFR2
UseAAVExpressionMammalianMutationS99A F102Y F104Y L178SPromoterSynapsinAvailable SinceJune 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPSU1
Plasmid#89439PurposeHigh copy number plasmid 1 to prepare Penn State DNA molecular weight laddersDepositorInsertsExpressionBacterialAvailable SinceApril 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-eNpHR 3.0-EYFP (AAV9)
Viral Prep#26971-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-CaMKIIa-eNpHR 3.0-EYFP (#26971). In addition to the viral particles, you will also receive purified pAAV-CaMKIIa-eNpHR 3.0-EYFP plasmid DNA. CaMKIIa-driven eNpHR 3.0-EYFP for optogenetic inhibition. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCaMKIITagsEYFPAvailable SinceMarch 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
SPLICS LY-MT Long P2A
Plasmid#213613PurposeDetect the long-range Lysosome-Mitochondria contactDepositorInsertSPLICS LY-MT Long P2A
ExpressionMammalianAvailable SinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
2X_pX458_pSpCas9(BB)-2A-GFP
Plasmid#172221PurposeCas9-2A-GFP expression vector bearing two (one additional) independent sgRNA cassettes.DepositorTypeEmpty backboneUseCRISPRTags3XFLAG and GFPExpressionMammalianPromoterCbhAvailable SinceSept. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-Scrambled
Plasmid#136035PurposeScrambled shRNA (negative control) inserted into the PLKO.1 plasmid (CCTAAGGTTAAGTCGCCCTCG)DepositorInsertNone (Scrambled)
UseLentiviralExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPSU2
Plasmid#89566PurposeHigh copy number plasmid 2 to prepare Penn State DNA molecular weight laddersDepositorInserts750 bp EcoRV fragment
3000 bp EcoRV fragment
4000 bp EcoRV fragment
50 bp PstI fragment
100 bp PstI fragment
200 bp PstI fragment
300 bp PstI fragment
400 bp PstI fragment
500 bp PstI fragment
600 bp PstI fragment
1500 bp Psti fragment
4100 bp PstI fragment
ExpressionBacterialAvailable SinceApril 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRC-CMV-Rev1b
Plasmid#204153PurposeLentivirus helper plasmid coding for RevDepositorInsertRev
ExpressionMammalianPromoterCMVAvailable SinceAug. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1 Lifeact-EGFP
Plasmid#58470PurposeExpresses a cytoplasmic actin filament reporter, the peptide Lifeact, on a CMV promoterDepositorInsertLifeact
TagsEGFPExpressionMammalianPromoterCMVAvailable SinceSept. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-EGFP (AAV2)
Viral Prep#50457-AAV2PurposeReady-to-use AAV2 particles produced from pAAV-hSyn-DIO-EGFP (#50457). In addition to the viral particles, you will also receive purified pAAV-hSyn-DIO-EGFP plasmid DNA. hSyn-driven, Cre-dependent EGFP expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsEGFP (Cre-dependent)Available SinceJan. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
mcherry-PH
Plasmid#36075DepositorAvailable SinceFeb. 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-dF-HA-KORD-IRES-mCitrine (AAV8)
Viral Prep#65417-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-hSyn-dF-HA-KORD-IRES-mCitrine (#65417). In addition to the viral particles, you will also receive purified pAAV-hSyn-dF-HA-KORD-IRES-mCitrine plasmid DNA. hSyn-driven, Cre-dependent KORD expression with bicistronic mCitrine, for SALB-induced neuronal inhibition. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCitrineAvailable SinceOct. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pC13N-dCas9-BFP-KRAB
Plasmid#127968Purposeconstitutive expression of dCas9-BFP-KRAB from the CLYBL locus (Ward lab)DepositorInsertCLYBL-CAG-dCas9-NLS-BFP-KRAB
UseTALENExpressionMammalianPromoterCAGAvailable SinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDEST-CMV-N-EGFP
Plasmid#122842PurposeN-terminal EGFP tag. Gateway destination vector for mammalian expression.DepositorTypeEmpty backboneUseGateway destinationTagsEGFPExpressionMammalianPromoterCMVAvailable SinceAug. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCHAC-mt-mKeima
Plasmid#72342Purposeretrovirus construct for stable expressing mt-mKeimaDepositorInsertmt-mKeima
UseRetroviralAvailable SinceJan. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
Antibody#213661-rAbPurposeAnti-Integrin αVβ3 (Human) chimeric recombinant antibody with fused human variable and rabbit constant domains; binds the particular alpha/beta chain pair, blocks ligand binding/function (RGD-mimetic)DepositorRecommended ApplicationsFlow CytometryReactivityHuman and MouseSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceMarch 27, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits
-