We narrowed to 10,024 results for: CAG
-
Plasmid#121071PurposeNegative control shRNA for plasmid 121070: shRNA targeting the 3'-untranslated region (UTR) of the gephyrin mRNADepositorInsertGPHN shRNA (Gphn Rat)
UseRNAiAvailable SinceFeb. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
gh46
Plasmid#106709Purposeexpression of gRNA targeting ST6GALNAC5DepositorInsertST6GALNAC5 (ST6GALNAC5 Human)
ExpressionMammalianAvailable SinceNov. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC45
Plasmid#104819PurposeCRISPR/Cas9 1xplex gRNA targeting Glyma.04g057400 (Dcl3a-2). Also expresses Cas9 from Gmubi promoter.DepositorInsertGlyma.04g057400
UseCRISPRExpressionPlantAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPN155
Plasmid#91684PurposeExpress sgRNA targeting human ZNF536DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
-
ATP1A1_G8_Dual_sgRNA
Plasmid#178104PurposeCoselection for PE3 in human cells. Vector for tandem expression of ATP1A1 G8 sgRNA with a user-specified PE3 nick sgRNA from two independent U6 promoters. Cloning of oligos using BbsI sites.DepositorInsertATP1A1 G8 sgRNA + user-specified sgRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSC50
Plasmid#104824PurposeCRISPR/Cas9 2xplex gRNA targeting Glyma.08g081600, Glyma.05g126600 (Hen1ab). Also expresses Cas9 from Gmubi promoter.DepositorInsertGlyma.08g081600, Glyma.05g126600
UseCRISPRExpressionPlantAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSB700
Plasmid#64046PurposeLentiviral vector for expressing U6 sgRNA and CAGGS Cerulean fluorescent proteinDepositorTypeEmpty backboneUseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterU6, CAGGSAvailable SinceMay 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-GSK3β-#1
Plasmid#32496DepositorAvailable SinceSept. 26, 2011AvailabilityAcademic Institutions and Nonprofits only -
pDY2261 hACTB atgRNA Paired Guide 1
Plasmid#220991PurposehACTB atgRNADepositorInsertACTB atgRNA (ACTB Human)
UseCRISPRAvailable SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
px330-TSC1
Plasmid#254275PurposeKnockout TSC1DepositorInsertTsc1 gRNA (Tsc1 Mouse)
UseCRISPRAvailable SinceApril 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-GFP-U6ac-ctrl-guides
Plasmid#168240Purpose"neutrophil specific GFP with ubiquitous ctrl sgRNAs"DepositorInsertcontrol sgRNAs
UseCRISPRAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLQ2827 pHR: U6-SpsgSV40 CMV-PYL1-KRAB-IRES-mCherry
Plasmid#84260PurposeExpresses Sp sgSV40 gRNA with ABA-inducible KRAB and mCherry for diametric regulationDepositorInsertsSp sgSV40
PYL1-KRAB
UseCRISPR and LentiviralTagsIRES-mCherry and PYL1ExpressionMammalianPromoterCMV and mouse U6Available SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX330-UBF
Plasmid#247350PurposeExpresses SpCas9 and a sgRNA targeting the human UBF loci for knock-in.DepositorAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
tet_pLKO.1_puro_shLuc
Plasmid#136587PurposeExpresses an inducible short hairpin targeting firefly luciferase sequenceDepositorInsertshLuc
UseLentiviralExpressionMammalianAvailable SinceJune 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-tetON-shRFP
Plasmid#110940PurposeTet-inducible shRNA targeting RFPDepositorInsertshRFP
UseLentiviral and RNAiPromoterH1/TOAvailable SinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-MC38-TCRB-32-riot_punisher
Plasmid#138988PurposeIVT template for the beta subunit of the mouse TCR #32 that is reactive against MC38DepositorAvailable SinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pL1M-pMtRC-MtLAP1-Adh-R1
Plasmid#170790PurposeA Root Tip-Specific Expressing Anthocyanin Marker for Direct Identification of Transgenic Tissues by the Naked Eye in Symbiotic StudiesDepositorInsertMtLAP1 (LOC11412013 Medicago truncatula)
ExpressionBacterial and PlantPromoterMedtr4g059670(MtRC)Available SinceAug. 12, 2021AvailabilityAcademic Institutions and Nonprofits only