We narrowed to 14,334 results for: TIM
-
Plasmid#76843Purpose3rd generation lentiviral gRNA plasmid targeting human PKD1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pSpG-PPE
Plasmid#170130PurposeFor plant prime editing in wheat plants or monocotyledons protoplastsDepositorInsertnCas9-SpG(H840A)-M-MLV
UseCRISPRExpressionPlantMutationH840A, D1135L, S1136W, G1218K, E1219Q, R1335Q, T1…Promotermaize Ubiquitin-1Available SinceMay 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
mCherry-CAD
Plasmid#73566PurposeSoluble red fluorescent activator of Orai1 channelsDepositorInsertmCherry-CAD (STIM1 342-448) (STIM1 Synthetic, Human)
Tags6x His and mCherryExpressionMammalianPromoterCMV Immediate EarlyAvailable SinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
3xNLS-NLP-cMyc-cMyc LbaCas12a
Plasmid#182125PurposepET21a protein expression vector for 3xNLS-NLP-cMyc-cMyc LbaCas12a in bacteriaDepositorInsert3xNLS-NLP-cMyc-cMyc LbaCas12a
Tags6xHisExpressionBacterialPromoterT7Available SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-Flex-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA
Plasmid#68717PurposeCre-dependent bicistronic vector expressing mRuby2 and GCaMP6s from a single open reading frame.DepositorHas ServiceAAV1InsertmRuby2-P2A-GCaMP6s
UseAAVMutationCre-dependent expression from inverted open readi…PromoterCAG-FLEXAvailable SinceJune 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHR-CD86-SmBiT
Plasmid#223618PurposeLentiviral expression of human CD86 with SmBiT tag in mammalian cellsDepositorAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
PRKCE gRNA (BRDN0001148049)
Plasmid#76791Purpose3rd generation lentiviral gRNA plasmid targeting human PRKCEDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDisplay-oROS-HT
Plasmid#216416PurposeTargeting of the chemigenetic, fluorescent peroxide sensor oROS-HT to the extracellular site of cell membranes.DepositorInsertpDisplay-oROS-HT
ExpressionMammalianPromoterCMVAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSH-EFIRES-P-GFP(1-10)opti
Plasmid#129416PurposeExpressing codon-optimized GFP(1-10) fragment in human cellsDepositorInsertcodon-optimized GFP(1-10)
UseCRISPR, TALEN, and Unspecified ; Human safe harbo…ExpressionMammalianPromoterEF-1αAvailable SinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDF-rM1PYK
Plasmid#220232PurposeInducible expression of rabbit muscle pyruvate kinase isoform 1DepositorAvailable SinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCIBN-tagBFP-hTRF2
Plasmid#103803PurposeBLInCR 'Localizer' construct that marks the telomeres and is targeted by a PHR-tagged effector upon illumination with blue lightDepositorExpressionMammalianMutationhTRF2: deletion of amino acids 1-42 and 476 compa…PromoterCMVAvailable SinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-Nsp13_GC3opt
Plasmid#157714Purposemammalian expression of untagged SARS-CoV-2 Nsp13 under control of a tetracycline-inducible promoterDepositorInsertNsp13-HF_GC3opt (ORF1ab SARS-CoV-2)
ExpressionMammalianMutationcodon optimized; gene expression was optimized by…Available SinceAug. 6, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pOPINB-hRNF216(511-784)
Plasmid#171923PurposeExpression of human RNF216 (Triad3A) codon optimized for E. coli and insect cells. Catalytic RBR-helix construct suitable for activity assays.DepositorInsertE3 ubiquitin-protein ligase RNF216 (RNF216 Human)
Tags3C protease cleavage site and 6x-His tagExpressionBacterialMutationcodon optimised for expression in E. coliPromoterT7Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
6xHis-MBP-TEV-mDvl2DEP(416-510)_pCDFduet
Plasmid#216387PurposeBacterial expression vector for MBP-tagged mouse Dvl2 DEP domain (residues 416-510)DepositorAvailable SinceApril 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUT_mNF-Cas13d-Triplex
Plasmid#227709PurposeLPUtopia matching RMCE donor plasmid with mCherry-P2A-RfxCas13d Negative-Feedback circuit. Include a 3' UTR Triplex motif as a template backbone for MONARCH 2.0 system.DepositorInsertmCherry-P2A-RfxCas13d-Triplex
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterCMV-d2iAvailable SinceNov. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
STK11 gRNA (BRDN0001147319)
Plasmid#75914Purpose3rd generation lentiviral gRNA plasmid targeting human STK11DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-Flex-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA
Plasmid#68720PurposeCre-dependent bicistronic vector expressing mRuby2 and GCaMP6s from a single open reading frame.DepositorHas ServiceAAV1InsertmRuby2-P2A-GCaMP6s
UseAAVMutationCre-dependent expression from inverted open readi…PromoterhSyn1-FLEXAvailable SinceJune 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMVA2
Plasmid#119951PurposeExpresses recombinant MVA pathway in Escherichia coliDepositorInsertsmvaE
mvaS
mvaK1
mvaK2
mvaD
idi
ExpressionBacterialMutationA110GAvailable SinceFeb. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS416d
Plasmid#87386PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only