We narrowed to 14,239 results for: CAN
-
Plasmid#124921PurposeFor expression of Conserved Region In Middle deletion mutant of SIN1-GFP (delta139-267)DepositorInsertMAPKAP1 (MAPKAP1 Human)
TagsTagGFP2ExpressionMammalianMutationInsert ORF was sirently mutated to be resistent t…Available SinceMay 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTagGFP2-N SIN1 deltaPH
Plasmid#124922PurposeFor expression of Pleckstrin Homology domain deletion mutant of SIN1-GFP (delta376-486)DepositorInsertMAPKAP1 (MAPKAP1 Human)
TagsTagGFP2ExpressionMammalianMutationInsert ORF was sirently mutated to be resistent t…Available SinceMay 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
p2R3a-3xVenusYFP-OcsT
Plasmid#71271PurposeEntry clone containing three repeats of Venus. Can be fused with linker to the C-terminal end of protein of interest. For use in plants and compatible with the MultiSite Gateway systemDepositorInsert3 times VenusYFP
UseGatewayTagsoctaline synthase terminatorAvailable SinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCIBN-hTRF1-tagRFP-T
Plasmid#103811PurposeBLInCR 'Localizer' construct that marks telomeres and is targeted by a PHR-tagged effector upon illumination with blue light; can be visualized without triggering PHR recruitmentDepositorAvailable SinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
SYKA-c020
Plasmid#175489PurposeProtein expression in bacterial cells. Tandem SH2 domains, M6-N269. Can be used for crystallography.DepositorAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
KRAS-P34R
Plasmid#158527PurposeExpresses human KRAS P34R in E. coli with amino terminal 6xHIS tag that can be removed with TEV protease.DepositorInsertKRAS (KRAS Human)
Tags6xHis-tag and TEV protease cleavage sequenceExpressionBacterialPromoterT5Available SinceSept. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOTTC292 - pAAV EF1a floxed hChR2(H134R)-EYFP
Plasmid#50834PurposeAn AAV packaging vector that expresses channel rhodopsin 2 (H134R) (fused to EYFP) under the EF1a promoter, which can be deactivated (deleted) by recombination between the flanking loxP sites.DepositorInserthChR2 (H134R)
UseAAV and Cre/LoxTagsEYFPExpressionMammalianMutationH134RPromoterEF1aAvailable SinceOct. 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pT2/GD-IRES-GFP-CTNNB1
Plasmid#192868PurposeCarries a Sleeping Beauty (SB) transposon vector that can be used to deliver an activated human CTNNB1(S33Y) transgene into cells, when a source of SB transposase is also co-introduced.DepositorInsertsluc+
EGFP
CTNNB1
ExpressionMammalianAvailable SinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCIBN-LacI-tagRFP-T
Plasmid#103810Purpose'Localizer' construct that marks lacO arrays and is targeted by a PHR-tagged effector upon illumination with blue light; can be visualized without triggering PHR recruitmentDepositorExpressionMammalianMutationLacI: C19T (silent, L7L), T264C (silent, A88A), C…PromoterCMVAvailable SinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAGE2.0
Plasmid#165984PurposeMulti-host shuttle vector that can be transferred by conjugation and replicate in S. meliloti, E. coli, S. cerevisiae, and P. tricornutum. Contains S. meliloti pSymA origin and Tet resistance.DepositorInsertsRK2/RP4 origin of transfer
repA2B2C2
nourseothricin N-acetyl transferase
tetracycline resistance
UseSynthetic Biology; Bacterial and yeast cloning; c…Available SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTagGFP2-N SIN1 delta2-29
Plasmid#124923PurposeFor expression of a.a.2-29 deletion mutant of SIN1-GFPDepositorInsertMAPKAP1 (MAPKAP1 Human)
TagsTagGFP2ExpressionMammalianMutationInsert ORF was sirently mutated to be resistent t…Available SinceMay 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-92a-1-5p
Plasmid#103750PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-92a-1-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-92a-1-5p target (MIR92A1 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
1073B(HomeR2) =pBac-[Pol-γ35.HL-decPol-γ35-p10]-[U6-gRNA#2(Pol-γ35)]-[3xp3-GFP-SV40]-Pol-γ35.HR-[Opie2-dsRed-SV40]
Plasmid#159677PurposePlasmid provides the HomeR#2 gene-drive element harboring a rescue, gRNA#2, and 3xP3-eGFP that can be integrated via pBac and inserted at Pol-γ35 site #2 via HDR.DepositorInsert[Pol-γ35.HL-decPol-γ35-p10]-[U6-gRNA#2(Pol-γ35)]-[3xp3-GFP-SV40]-Pol-γ35.HR-[Opie2-dsRed-SV40]
ExpressionInsectAvailable SinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pscAAV- EF1α core -NaChBac
Plasmid#246997PurposeCan be used to generate AAV virus that will express NaChBac from EF1α core promoterDepositorInsertNaChBac
UseAAVPromoterEF1αAvailable SinceMarch 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV-mCherry:T2A:Bsd-EF1A-HA3xGShGLI1
Plasmid#249270PurposeExpression of GLI1DepositorAvailable SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCEFL PRKACA HA WT
Plasmid#249271PurposeExpression of PKA (PRKACA) wild typeDepositorAvailable SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCEFL PRKACA HA R135W
Plasmid#249274PurposeExpression of PKA R135W mutant (PRKACAR135W)DepositorAvailable SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCEFL PRKACA HA E171K
Plasmid#249275PurposeExpression of PKA E171K mutant (PRKACAE171K)DepositorAvailable SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCEFL PRKACA HA T49I
Plasmid#249272PurposeExpression of PKA T49I mutant (PRKACAT49I)DepositorAvailable SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only