We narrowed to 14,926 results for: EGF
-
Plasmid#190824PurposeFor mammalian expression of β-catenin with 4 O-GlcNAc sites mutated (S23A, T40A, T41A and T112A) and GFP-tag on its N-terminus.DepositorInsertβ-catenin (CTNNB1 Chicken)
TagsGFPExpressionMammalianMutationS23A, T40A, T41A, T112APromoterCMVAvailable SinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-Ef1a-fDIO-eGFP-WPRE
Plasmid#203843PurposeFlp-dependent EGFP expressionDepositorInsertEGFP
UseAAVAvailable SinceOct. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1A-EGFP-PARP1
Plasmid#176146PurposeEGFP fused to the N-terminus of PARP1 & a hygromycin resistance cassetteDepositorInsertPoly(ADP-Ribose) Polymerase 1 (PARP1 Human)
UseLentiviralTagsEGFPExpressionMammalianPromoterEF1AAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-ConVERGD-eGFP-W3SL
Plasmid#218748PurposeProvides AND intersectional (Cre+Flp) expression of eGFPDepositorInserteGFP
UseAAVPromoterCAGAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL WT (siRNA resistant)
Plasmid#191011PurposeExpresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
5'UTR CGG 99x FMR1-EGFP
Plasmid#63091PurposeContains expanded CGG repeats (99 repeats) within the 5'UTR of FMR1 as found in the Fragile X Tremor Ataxia Syndrome (FXTAS). These repeats are in frame with EGFP.DepositorInsertexpanded CGG repeats (99 repeats) within the 5'UTR of FMR1 (FMR1 Human)
TagsEGFPExpressionMammalianPromoterCMVAvailable SinceApril 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV-ABE8.8m-WT-P2A-EGFP (BKS953)
Plasmid#242651PurposeCMV promoter expression plasmid for human codon optimized ABE8.8m A-to-G base editor with SpCas9(D10A) and P2A-EGFPDepositorInsertpCMV-ABE8.8m-SpCas9-P2A-EGFP
UseCRISPRExpressionMammalianMutationABE8.8 mutations in TadAPromoterCMV and T7Available SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEG BacMam N term StrepII eGFP 3C
Plasmid#160683PurposeVector optimized for use in screening assays, as well as for efficient production of baculovirus and robust expression of the target proteinDepositorTypeEmpty backboneTagsStrepII eGFP 3CExpressionMammalianPromoterCMVAvailable SinceDec. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-EF1A-Gephyrin.FingR-eGFP-CCR5TC
Plasmid#125692PurposeGlobal labeling of inhibitory synapses (green fluorescence)DepositorInsertGephyrin.FingR-eGFP-CCR5TC
UseAAVExpressionMammalianPromoterEF1AAvailable SinceJuly 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-PGK-EGFP-ALDH1A3-Neo
Plasmid#189744PurposeThe construct was used to express GFP tagged human ALDH1A3 in mammalian cells for the analysis of the subcellular location of this protein.DepositorAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
RabV CVS-N2c(deltaG)-EGFP
Plasmid#73461PurposeExpresses EGFP for monosynaptic circuit mappingDepositorInsertEGFP
UseNeurotropic virusAvailable SinceJune 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-Archon1-KGC-EGFP
Plasmid#108418PurposeAAV production plasmid encoding for Archon1 fluorescent voltage reporterDepositorInsertArchon1-KGC-EGFP
UseAAVExpressionMammalianPromoterCaMKIIAvailable SinceJune 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-SpCas9(H840A)-T2A-EGFP
Plasmid#221231PurposeExpress nCas9 nickase (H840A) with GFP reporterDepositorInsertSpCas9(H840A)-T2A-EGFP
ExpressionMammalianMutationH840AAvailable SinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-Akt-FoxO3a-KTR-EGFP
Plasmid#125131PurposeFluorescent reporter for Akt activityDepositorInsertFOXO2 (FOXO3 Human)
TagsEnhanced green fluorescent protein (EGFP)ExpressionMammalianMutationFoxO3A 1-402 amino acidPromoterCAG promoterAvailable SinceJune 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
lenti F9-TetR-EGFP-IRES-PuroR
Plasmid#117049Purposelentiviral vector for expression of TetR-EGFP, for visualization of TetO repeatsDepositorInsertF9-TetR-EGFP
UseLentiviralTagsEGFPExpressionMammalianPromoterF9 promoterAvailable SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRK5-mEGFP-HMGB1-MUT-Patchless
Plasmid#194553PurposeMammalian Expression of mEGFP-HMGB1 Mutant (K184Rfs*44) Fusion Protein, "Patchless" variantDepositorInsertHMGB1 (HMGB1 Human)
TagsmEGFPExpressionMammalianMutationK184Rfs*44, truncation by stop codon after Lys209Available SinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
EGFP human Rab27a isoform-1 T23N
Plasmid#245022PurposeDominant negative human Rab27a T23N mutantDepositorAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE-TIGHT-EGFP-backward donor
Plasmid#22077DepositorInsertTETO-eGFP
Available SinceOct. 5, 2009AvailabilityAcademic Institutions and Nonprofits only -
pBluescript II NLS-MC-EGFP-tdTomato (pBET2)
Plasmid#240411PurposeThis plasmid facilitates the assessment of MMR proficiency in human living cellsDepositorInsertNLS-EGFP fusion protein
ExpressionMammalianPromoterCMVAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTRE-TIGHT-EGFP-donor fw copy
Plasmid#22074DepositorInsertTETO-eGFP
Available SinceSept. 28, 2009AvailabilityAcademic Institutions and Nonprofits only