We narrowed to 81,643 results for: TRI
-
Plasmid#69840PurposeThis plasmid encodes PLK4 isoform 1 carrying an S305E mutation with an N-terminal EGFP tag and C-terminal 3xFLAG tagDepositorAvailable SinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only
-
pcDNA3-Cerulean3-Cerulean3-FLARE-CKAR
Plasmid#123346PurposeCyan-fluorescent homoFRET/anisotropy-based biosensor for monitoring Protein Kinase C activity.DepositorInsertCerulean3-Cerulean3-FLARE-CKAR
Tags6xHIS, Cerulean3, T7 tag (gene 10 leader), and Xp…ExpressionMammalianPromoterCMVAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C3-PLK4-S285A/T289A-3xFLAG
Plasmid#69841PurposeThis plasmid encodes PLK4 isoform 1 carrying S285A/T289A mutations with an N-terminal EGFP tag and C-terminal 3xFLAG tagDepositorInsertPLK4 (PLK4 Human)
Tags3xFLAG tag and EGFPExpressionMammalianMutationS285A/T289APromoterCMVAvailable SinceDec. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
HOXB4 (human) FLAG MSCV
Plasmid#8528DepositorInsertHOXB4 (HOXB4 Human)
UseRetroviralTagsFLAGExpressionMammalianMutationMissing N-terminal 14 amino acids; improved Ribos…Available SinceMay 30, 2006AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-HLA-A2-VN
Plasmid#135485PurposeMammalian expression of VN-fused and myc-tagged HLA-A*02:01DepositorInsertHLA-A*02:01 (HLA-A Human)
TagsExtracellular c-myc epitope tag, Signal peptide f…ExpressionMammalianPromoterCMVAvailable SinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMT-flk1-cytoBirA-2A-mCherry_Ras
Plasmid#80056PurposeFlk1/Kdrl promoter driving HA-tagged biotin ligase (BirA), a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA), a Thosea asigna virus peptide (2A), and mCherry protein
Tags3x HAExpressionBacterialPromoterflk1Available SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
p1193-scAAV-U6-sgRNA_Nme2Cas9_Rosa26-CB-PI-AcrIIC3Nme_FLAG_NLS-3XmiR122BS
Plasmid#129531PurposeSelf-complementary AAV vector expressing Nme2Cas9 sgRNA targeting Rosa26 and AcrIIC3Nme with 3x miR-122 binding sites in 3' UTRDepositorInsertscodon-optimized AcrIIC3Nme
sgRNA_Rosa26
UseAAVTagsFLAG/NLSPromoterU6 and cytomegalovirus-enhancer chicken β-actin p…Available SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-GFP-GFP-FLARE-AKAR
Plasmid#123332PurposeGreen-fluorescent homoFRET/anisotropy-based biosensor for monitoring Protein Kinase A activity.DepositorInsertGFP-GFP-FLARE-AKAR
Tags6xHIS, EGFP, T7 tag (gene 10 leader), and Xpress …ExpressionMammalianPromoterCMVAvailable SinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEMS2044
Plasmid#79652PurposessAAV genome with Ple255 (PAX6 MiniPromoter) driving an emerald GFP (EmGFP) reporter. Contains WPREDepositorInsertssAAV Ple255-EmGFP WPRE
UseAAVPromoterPAX6 HS234Z EnhancerAvailable SinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCS3-MT-BX/ARF1-64
Plasmid#78762PurposeTo overexpress ARF1-64 in Mammalian CellsDepositorAvailable SinceJune 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCS3-MT-BX/ARF65-132
Plasmid#78763PurposeTo overexpress ARF65-132 in Mammalian CellsDepositorAvailable SinceJune 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti-SwitchON-sgCh2-2
Plasmid#199637PurposeTamoxifen-inducible expression of sgRNA control targeting intergenic regionDepositorInsertN/A
UseLentiviralAvailable SinceJune 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEX-6P-1-INTS3-N
Plasmid#128416PurposeExpress INTS3 N-termini (1-513 aa) in E. coli with a GST tag (N-terminal)DepositorInsertINTS3 (INTS3 Human)
TagsGSTExpressionBacterialMutationN-terminal region (1–513 aa)Promotertac promoterAvailable SinceAug. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
HH06-LP Clone 6 heavy chain
Plasmid#192176PurposeClone 6 heavy chain (HH06)DepositorInsertClone 6 heavy chain (HH06)
ExpressionMammalianMutationNAAvailable SinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
HOXB4 (human) HA-TAT-tag pET
Plasmid#8526DepositorInsertHOXB4 (HOXB4 Human)
TagsHAExpressionBacterialMutationreplace T7 and HIS tags of pET with an HA tag;Available SinceMay 30, 2006AvailabilityAcademic Institutions and Nonprofits only -
p221- purVSG117UTR
Plasmid#59732PurposeInserts a puromycin resistance gene and a VSG117 gene into the VSG221 expression site of T.brucei downstream of the expression site promoter.DepositorInsertVSG117 flanked upstream and downstream by sequences homologous to the VSG221 expression site
UseFor homologous recombination into vsg221 expressi…Available SinceAug. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ oDam_f_GFPoNLS
Plasmid#85819PurposeiDamID plasmid. To express transiently the optimized E. coli Dam adenine methyltransferase fused to the nuclear-localized mmGFP via flexylinker.DepositorInsertoDam_f_GFPoNLS
TagsoNLS (optimized nuclear localization signal) C te…ExpressionBacterial, Insect, Mammalia…MutationL122A. Codon optimization compatible to work in M…Available SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGBT9-Hook2
Plasmid#198524PurposeExpression of GAL4 DNA-binding domain (BD)-Hook2 fusion protein in yeast (yeast two-hybrid assays)DepositorInsertHook2 (HOOK2 Human)
TagsGAL4-DNA binding domain fragmentExpressionYeastMutationHis488Gln substitutionPromoterADH1Available SinceApril 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPKm-245
Plasmid#90503PurposeExpresses HO1, PCYA, FD and FNR, required for PCB synthesis. pSIN - EF-1alpha - MTS - tHO1 - P2A - MTS - tPCYA - P2A - MTS - tFD - P2A - MTS - tFNRDepositorInsertmito-tHO1, mito-tPCYA, mito-tFD, mito-tFNR
UseLentiviralAvailable SinceApril 4, 2018AvailabilityAcademic Institutions and Nonprofits only