We narrowed to 26,706 results for: vit;
-
Plasmid#10730DepositorAvailable SinceOct. 7, 2005AvailabilityAcademic Institutions and Nonprofits only
-
pCAT105
Plasmid#180510PurposePlasmid expressing mammalian codon optimized engineered DpbCasX-R3, sgRNAv2 scaffold, and restriction sites to clone in new spacersDepositorInsertsCasX sgRNAv2
DpbCasX with R3 loop
UseCRISPRTags2x FLAG and SV40 NLSExpressionMammalianPromoterCAG and U6Available SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
Human a3 nicotinic receptor subunit EM construct
Plasmid#163960PurposepEZT-BM vector with alpha3 gene after CMV promoter, published EM constructDepositorInsertHuman alpha3 nicotinic acetylcholine receptor subunit EM construct
UseBaculovirus (bacmam) production and mammalian exp…Tagsapocytochrome b(562)RIL (BRIL)ExpressionMammalianMutationAsn348-Ser402 replaced with apocytochrome b(562)R…PromoterCMVAvailable SinceFeb. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
1_T7-mScarlet3-Hras
Plasmid#225928PurposeIn vitro synthesis of mRNA for fluorescent protein mScarlet3 tagged with the H-Ras membrane localisation signalDepositorInsertmScarlet3-HRas
UseIn vitro transcriptionPromoterT7Available SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
S1PR1-DuET
Plasmid#213374PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
498 pSG5L HA RB del663 (NAAIRS)
Plasmid#10728DepositorInsertRB del663 (RB1 Human)
TagsHAExpressionMammalianMutationresidues 664 to 669 were replaced by NAAIRS, a fl…Available SinceSept. 27, 2005AvailabilityAcademic Institutions and Nonprofits only -
pPyPGK-Myc-LaG17-SynNotch-tTA-IRES-Ble
Plasmid#183607PurposeMammalian expression vector: mouse Pgk1 promoter driving expression of a SynNotch receptor comprising anti-GFP nanobody (LaG17), mouse Notch1 core, tTA. Confers bleomycin/zeocin resistance.DepositorInsertLaG17 GFP nanobody SynNotch tTA
TagsMyc and human CD8a signal sequenceExpressionMammalianPromoterMouse Pgk1Available SinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
Cterminal HA Mios pRK5
Plasmid#46329DepositorAvailable SinceJuly 15, 2013AvailabilityAcademic Institutions and Nonprofits only -
AAV-SYN_mEGFP-CREB
Plasmid#137006PurposeAAV backbone, mEGFP-CREB donor for G-CREBDepositorAvailable SinceMay 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTet-GLI2shR
Plasmid#136691PurposeInducible Gli2 shRNA lentiviral plasmid (target sequence: human GLI2 5′CCGGCCTGGCATGACTACCACTATGCTCGAGCATAGTGGTAGTCATGCCAGGTTTTTG 3′)DepositorInsertshRNA_humanGli2 (GLI2 Human)
UseLentiviralAvailable SinceJune 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
8xCTS1_deltaC55G-hutRNApro_BsmBIplch-SAMsgRNA_14nt Buffer_deltaC55G-hutRNApro_SV40polyA
Plasmid#124537PurposeCloning vector for tRNA-released synergistic activation mediator gRNA. BsmBI flanked placeholder for spacer cloning.DepositorInsertdeltaC55G-hutRNApro_BsmBIplch-SAMsgRNA_14nt Buffer_deltaC55G-hutRNApro
ExpressionMammalianMutationd11-41 C55G, d11-41 C55GPromoterMinimal ADEAvailable SinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pF709-pET28a-Hs-FL-ETFbeta-NHis wt
Plasmid#85110Purposeexpression of recombinant human full-length ETFbeta wt with N-terminal 6xHis-tagDepositorAvailable SinceNov. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
p2T-cmv-SpCas9-TadCBEa-BlastR
Plasmid#193847PurposeExpress TadCBEa in mammalian cells with BlastR selection, Tol2 integrationDepositorInsertTadCBEa
ExpressionMammalianAvailable SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-SYN_mCherry-KIX-mCherry
Plasmid#137007PurposeAAV backbone, mCherry-KIX acceptor for G-CREBDepositorAvailable SinceMay 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
MLKL gRNA (BRDN0001148608)
Plasmid#77539Purpose3rd generation lentiviral gRNA plasmid targeting human MLKLDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MLKL gRNA (BRDN0001146456)
Plasmid#77540Purpose3rd generation lentiviral gRNA plasmid targeting human MLKLDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAV-Syn-FLEX-rc [SomArchon-GFP]
Plasmid#153533PurposeAAV-mediated expression of SomArchon-GFP under the Syn promoter, in floxed/reversed (Cre-dependent) manner.DepositorInsertSomArchon-GFP
UseAAVTagsER2, GFP, and KGCExpressionMammalianPromoterSynAvailable SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
CHRM1-DuET
Plasmid#213207PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO-Intron-CterFlag-MePCE
Plasmid#113549PurposeMammalian expression plasmid that can be used with the Flp-In T-REx system.DepositorAvailable SinceJuly 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
Dnase1L3 R206C pIRES-DsRed
Plasmid#98847PurposeExpresses Human Dnase1L3 with activity-reducing HUVS mutation R206C in mammalian cells along with DsRedDepositorInsertDnase1L3 (DNASE1L3 Human)
TagsIRES DsRedExpressionMammalianMutationR206C which greatly reduces nuclease activityPromoterCMVAvailable SinceDec. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
GPR25-DuET
Plasmid#213277PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.Flex.NES-jRGECO1b.WPRE.SV40
Plasmid#100855PurposeAAV expression of Cre recombinase-activated jRGECO1b, a red fluorescent calcium sensor protein, from the CAG promoterDepositorInsertjRGECO1b
UseAAVExpressionMammalianPromoterCAGAvailable SinceFeb. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
Flag WDR24 pLJM1
Plasmid#46337DepositorAvailable SinceJuly 15, 2013AvailabilityAcademic Institutions and Nonprofits only -
pET28a-SENP6 (catalytic domain)
Plasmid#16359DepositorInserthuman SENP6 catalytic domain (SENP6 Human)
TagsHisExpressionBacterialMutationAmino Acid 628 to 1112 catalytic domain of human …Available SinceDec. 19, 2007AvailabilityAcademic Institutions and Nonprofits only -
pPBC-LG3-tdT
Plasmid#62810PurposepPBC-LG3-tdT expresses PiggyBac inverted terminal repeat-flanked Lck-GCaMP3 and tdTomato under the control of the CAG promoter.DepositorInsertITR-CAG-Lck-GCaMP3-IRES-tdTomato-ITR
ExpressionBacterial and MammalianPromoterCAGAvailable SinceMay 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
2_T7-mScarlet3-KRas
Plasmid#225929PurposeIn vitro synthesis of mRNA for fluorescent protein mScarlet3 tagged with the K-Ras membrane localisation signalDepositorInsertmScarlet3-KRas
UseIn vitro transcriptionPromoterT7Available SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001146145)
Plasmid#80198Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
Designed VEGF-binding scFv G6des13
Plasmid#110213PurposeYeast Surface Display of G6des13DepositorInsertG6des13
Tagscmyc tagExpressionYeastMutationL A43P, L Q89L, L T94D, L P95T, H Y59H, H Y95FAvailable SinceJuly 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEMS2155
Plasmid#141065PurposeAAV plasmid with SYN1 promoter driving expression of EmGFP. Contains WPRE.DepositorInsertSYN1-EmGFP-WPRE
UseAAVPromoterhuman SynapsinAvailable SinceApril 28, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA3-AktAR
Plasmid#61624PurposeFRET-based biosensor for monitoring Akt activityDepositorInsertAktAR (AKT1 Budding Yeast, Synthetic, Human)
TagsCerulean and cpVenus[E172]ExpressionMammalianPromoterCMVAvailable SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only