We narrowed to 8,392 results for: crispr grnas
-
Plasmid#158393PurposeGolden Gate entry vector to express the 1st gRNA with tRNA2.0 scaffold (with four MS2 binding sites) without promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterWithout promoterAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pUDP123
Plasmid#107269PurposepUDP123 expressing a polycistronic g-RNA array for Cas9 editing targeting the genes OpADE2 and OpNIAD and Spcas9D147Y P411T in O. parapolymorpha (HH-gRNAOpADE2-HDV-linker-HH-gRNAOpNIAD-HDV)DepositorInsertpolycistronic HH-gRNA-HDV-HH-gRNA-HDV array targetting OpADE2 and NIAD in O. parapolymorpha
ExpressionYeastPromoterScTDH3Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
bRA89
Plasmid#100950PurposeCas9 driven by PGK1 promoter. gRNA can be cloned into the BplI sites. HPH markerDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceSept. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCE27
Plasmid#174405PurposeC. auris LEUpOUT NAT marker gRNA expression construct. Use with pCE35 CAS9 expression construct.DepositorInsertNAT 2 of 2, pSNR52, ADE2 gRNA, gRNA conserved, C. auris LEU2 2 of 2
UseCRISPRExpressionBacterialAvailable SinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
Fragment1 with TLS2
Plasmid#196983PurposeGateway-compatible gRNA backbone with TLS2 mobility signal. Template for the addition of target sequences to produce 2x graft-mobile gRNA-TLS2.DepositorInsertIntermediate fragment for assembly of gRNA-TLS2 construct
UseGateway CloningAvailable SinceMay 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
bRA66
Plasmid#100952PurposeGAL1 driven Cas9. gRNA can be cloned into BplI sites.DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceSept. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
(559) pAAV EF-1a KRAB-SadCas9 U6-gRNA
Plasmid#163024PurposeExpression of CRISPRi with U6-gRNA (Bsa1 sites)DepositorInsertMammalian codon-optimized SadCas9
UseAAVTagsKRAB, SV40 polyA, and myc NLSExpressionMammalianPromoterhEF-1aAvailable SinceJan. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCE35
Plasmid#174409PurposeC. auris LEUpOUT NAT marker CAS9 expression construct. Use with pCE27 gRNA expression construct.DepositorInsertC. auris LEU2 1 of 2, pENO1, Cas9, NAT 1 of 2
UseCRISPRExpressionBacterialAvailable SinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG12R/sgKras/Cre
Plasmid#99852PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12R mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCas39
Plasmid#82389PurposesgRNA targeting glnA expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPEZ3Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas36
Plasmid#82388PurposesgRNA targeting ccmK expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPEZ3Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas35
Plasmid#82387PurposesgRNA targeting cpcB expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPEZ3Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas15
Plasmid#82383PurposesgRNA targeting YFP (truncated to 18 bp) expressed from pJ23119 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPJ23119Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas14
Plasmid#82382PurposesgRNA targeting YFP (truncated to 15 bp) expressed from pJ23119 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPJ23119Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas13
Plasmid#82381PurposesgRNA targeting YFP (truncated to 12 bp) expressed from pJ23119 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPJ23119Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pYPQ134B
Plasmid#179216PurposeGolden Gate entry vector; 4th gRNA under AtU3 promoterDepositorTypeEmpty backboneUseCRISPRPromoterAtU3Available SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMOD_C2200
Plasmid#91082PurposeModule C, Promoter: none – to be combined with gRNA array in module B, Gene: SapI ccdb cassette for cloning multiple gRNA spacers with Csy4 spacers (only works with pMOD_B2203), Terminator: 35SDepositorInsertSapI ccdb cassette for cloning multiple gRNA spacers with Csy4 spacers
UseCRISPRPromoternone (will be fused to gRNA array in MODULE B)Available SinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Puro-sgMARK2
Plasmid#138689PurposeExpresses a human MARK2-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Blast-sgCRTC2-1
Plasmid#138700PurposeExpresses a human CRTC2-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only