We narrowed to 12,145 results for: SHA
-
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
YFP-FKBPx5-His
Plasmid#103785Purposeexpresses His-tagged iPOLYMER component in E. coli for protein purificationDepositorInsertYFP-FKBPx5-His
TagsEYFP, His-tagExpressionBacterialPromoterT7Available SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcdna3 Flag Jip2
Plasmid#59027Purposeact as molecular scaffolds that mediate the activation of the JNK signaling pathway in vivo.DepositorInsertmitogen-activated protein kinase 8 interacting protein 2 (MAPK8IP2 )
TagsFlagExpressionMammalianAvailable SinceSept. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pcoCASphi_E9t_version2_U6_AtPDS3_gRNA10
Plasmid#197952PurposeT-DNA binary vector to express pcoCasphi driven by UBQ10 gene promoter, with SV40 NLS at the C-terminal , and the AtPDS3 guide RNA 10 driven by U6 promoter.DepositorInsertspcoCasphi-2
AtPDS3 gRNA10
UseCRISPRExpressionPlantPromoterAtU6-26 and pUBQ10Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
mEmerald-H2B-C-10
Plasmid#54112PurposeLocalization: Nucleus/Histones, Excitation: 487, Emission: 509DepositorInsertH2B (H2BC11 Human)
TagsmEmeraldExpressionMammalianMutationD26G and V119I in H2BPromoterCMVAvailable SinceJune 16, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMM9-MAPKK2-WT
Plasmid#40805DepositorAvailable SinceOct. 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
pJG85
Plasmid#89281PurposeEntry vector containing the TaU6 promoter and an Esp3I Golden Gate cloning site for cloning of the sgRNA, all between attL5 and attL2 sitesDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMay 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
px552-sg-gria1-HT-SEP
Plasmid#187653PurposeContains HaloTag-SEP to be inserted into the NTD of Gria1 (via HITI) and single guide RNA to target Cas9 to Gria1 under control of the U6 promoter.DepositorInsertHaloTag-SEP donor
UseAAV and CRISPRTagsN/APromoterN/AAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-kanMX6-PGAL1-GST
Plasmid#41611DepositorInsertGAL1 promoter (GAL1 Budding Yeast)
UseYeast genomic targetingTagsA. gossypii translation elongation factor 1a gene…Available SinceDec. 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
Clover-PDHA1-N-10
Plasmid#56304PurposeLocalization: Mitochondria, Excitation: 505, Emission: 515DepositorAvailable SinceDec. 5, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
Flag-ECFP-GIT1
Plasmid#15223DepositorInsertG protein coupled receptor kinase-interacting protein 1 (GIT1 Human)
TagsECFP and flagExpressionMammalianAvailable SinceSept. 13, 2007AvailabilityAcademic Institutions and Nonprofits only -
SaLgCP
Plasmid#164562PurposePuroDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsFlag-NLS-SaCas9-P2A-PuroRExpressionMammalianPromoterU6 promoter for crRNA expression and EFS promoter…Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
GalT-moxDendra2
Plasmid#89789Purposemammalian expression of GC localized moxDendra2DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUBQ10::ZF108_3xFLAG_YPet
Plasmid#106441PurposepUBQ10 driven Zinc Finger YPet fusion that targets the FWA promoter in arabidopsisDepositorInsertZF108_3xFLAG_YPet
UseSynthetic BiologyExpressionPlantAvailable SinceMarch 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBLO2 casX
Plasmid#123122PurposeE. coli expression vector for CasX sgRNADepositorInsertCasX guide RNA
UseCRISPRAvailable SinceMarch 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-HA-hTRAF3 1-448
Plasmid#44033DepositorInsertTNF receptor-associated factor 3 (TRAF3 Human)
Tags1xHAExpressionMammalianMutationContains amino acids 1-448; V274D and S393GAvailable SinceApril 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_antiCD19_Z3_Gal4VP64
Plasmid#169916PurposeExpression of a synNotch receptor containing antiCD19, a zebrafish Notch core and Gal4VP64.DepositorInsertantiCD19-Notch3-GL4VP64
UseLentiviralExpressionMammalianPromoterPGKAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEJS433-pCSDest2-AcrIIC1Nme
Plasmid#85679PurposeMammalian expression of Type II-C anti-CRISPR protein AcrIIC1Nme from Neisseria meningitidisDepositorInsertType II-C anti-CRISPR AcrIIC1Nme
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
mRuby2-Nup50-N-10
Plasmid#55908PurposeLocalization: Nuclear Pore, Excitation: 559, Emission: 600DepositorAvailable SinceMarch 10, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
HM3C NaVAe1_p pET24b
Plasmid#127854PurposeBacterial expression vector for NaVAe1 bacterial sodium channel residues 143-288. It expresses HIStag-MBP-3C-channel protein.DepositorInsertNaVAe1p
Tags3C Cleavage site, His, and MBPExpressionBacterialAvailable SinceMay 15, 2020AvailabilityAcademic Institutions and Nonprofits only