We narrowed to 19,248 results for: Tat
-
Plasmid#148112PurposeMammalian Expression of HshnRNPA1DepositorInsertHshnRNPA1 (HNRNPA1 Human)
ExpressionMammalianMutationone non silent mutation I136V compared to the tra…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-sgMaob-HepmCherry
Plasmid#192829PurposeExpresses sgRNA targeting Maob and mCherry from hepatocyte-specific promoterDepositorInsertmCherry
UseCRISPR and LentiviralExpressionMammalianPromoterU6 for sgRNA and hepatocyte-specific promoter (HS…Available SinceNov. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT005
Plasmid#182715PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-77:TERF2-mEGFP
Plasmid#168798PurposeHomology arms and mEGFP-linker sequence for N-terminus tagging of human TERF2.DepositorInsertTERF2 (TERF2 Human)
UseCRISPR; Donor templateTagsmEGFP-linkerExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceApril 14, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
BE3-hA3A-R128A
Plasmid#132944PurposeGene editing. See Gene/Insert section of the plasmid page for targeting sequence cloned into this plasmid.DepositorInsertBE3-hA3A(R128A)
UseCRISPR; Base editorExpressionMammalianMutationBE3-hA3A(R128A)Available SinceNov. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNCST-AvicFP4
Plasmid#129507PurposeExpresses AvicFP4 constitutively in E. coli (most strains)DepositorInsertAvicFP4
ExpressionBacterialMutationOne of two variants of AvicFP4 tested with essent…Promotersynthetic constitutive (stationary phase) promote…Available SinceFeb. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HA-VprBP (C590)
Plasmid#133589PurposeExpresses human VprBP C590 mutant in mammalian cellsDepositorInsertVpr (HIV-1) binding protein (DCAF1 Human)
TagsHAExpressionMammalianMutationC590 mutation of human VprBP lacking the N-termin…Available SinceJan. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCambia2300 - ProRUBY:RUBY-Citrine
Plasmid#128796PurposeFluorescent reporter for subcellular localisation and expression analysis of RUBYDepositorInsertRUBY PARTICLES IN MUCILAGE (AT1G19900 Mustard Weed)
TagsCitrineExpressionPlantPromoterProRUBYAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTR_L1-BirA(R118G)-NES-YFP-STOP-L2
Plasmid#127357Purposegateway entry vector for expressing cytosolic BirA* (R118G)-YFP under a promoter of choiceDepositorInsertBirA* (R118G mutant)
UseGateway CloningTagsGS linker, NES, V5, and YFPMutationR118GPromoterno promoterAvailable SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRG/III-hs-MBP-T43NTR-TrxA-H10
Plasmid#121677PurposeBacterial expression of neurotensin receptor fusion proteinDepositorInsertneurotensin receptor (Ntsr1 Rat)
TagsTrxA-H10ExpressionBacterialMutationdeleted amino acids 1-42PromoterlacAvailable SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
EF1a_MYC Ser62Ala_P2A_Hygro_Barcode
Plasmid#120514PurposeBarcoded lentiviral vector to express MYC Ser62Ala in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorInsertMYC Ser62Ala (MYC Human)
UseLentiviralMutationPoint mutation changing Serine to Alanine at amin…PromoterEF1aAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-RAB-AKARev(T/A)
Plasmid#118479PurposeNegative-control mutant for RAB-AKARev biosensor.DepositorInsertRAB-AKARev(T/A)
Tags6xHIS, T7 tag (gene 10 leader), and Xpress (TM) t…ExpressionMammalianMutationContains Thr-to-Ala mutation in substrate sequenc…PromoterCMVAvailable SinceDec. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEX-SF3B1-NTerm
Plasmid#97425PurposeExpresses human SF3B1 (AA 1-500) with N-term GST tag for inducible expression in E.coliDepositorInsertSF3B1-N-term (AA1-500)
TagsGSTExpressionBacterialMutationSilent mutation at nt876, aa289 (AGG to AGA)PromotertacAvailable SinceMay 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
MSCV Puro SCRIB P305L
Plasmid#88887PurposeSCRIB - Proline to Lysine mutation at 305 a.a. in MSCV backboneDepositorInsertSCRIB (SCRIB Human)
UseRetroviralMutationProline to Leucine mutation @ 305th amino acidPromoterMSCV promoterAvailable SinceMarch 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRSET a sfMatryoshCaMP6s-T78H
Plasmid#100021PurposeBacterial expression of fluorescent reporter for calcium signaling, based off of GCaMP6s. Contains a stable reference LSSmOrange nested within the reporting superfolder cpGFP-T78HDepositorInsertsfMatryoshCaMP6s
Tags6x HIS tag and Xpress_EK tagExpressionBacterialMutationcpEGFP replaced with superfolder cpGFP and T78H m…PromoterT7Available SinceOct. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLgw EcoDam-V5-SRF
Plasmid#98602PurposeMammalian DamID lentiviral vector forSRF with Dam-V5 using Gateway cloningDepositorInsertSRF (Srf Mouse)
UseLentiviral; DamidTagsDam (DNA adenine methyltransferase) and V5ExpressionMammalianPromoterHeat Shock Minimal PromoterAvailable SinceJuly 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDsred monomer C1- MLPH
Plasmid#89236PurposeExpression of Dsred-tagged human Melanophilin in mammalian cellsDepositorInsertHuman Melanophilin (MLPH Human)
TagsDsred monomerExpressionMammalianMutationwild typePromoterCMVAvailable SinceApril 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_KRAS_p.G13V
Plasmid#82800PurposeGateway Donor vector containing KRAS, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -