We narrowed to 6,854 results for: itch
-
Plasmid#227385PurposeAdhesion module, creates 'seed' at telomereDepositorInsertTelomeric iLID (TERF1 Human)
UseLentiviralAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHD57 [Tol2-UAS:sypb-egfp-cry2-polyA]
Plasmid#198381PurposeExpression of SYPB::CRY2olig(535) in neurons of Danio rerioDepositorInsertUAS:sypb-egfp-cry2
UseTol2TagsEGFPMutationD387APromoterUASAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCS2-Opto-Alk3
Plasmid#207614PurposeZebrafish Alk3 BMP receptor kinase domain fused to VfLOVDepositorInsertAlk3 (bmpr1aa) kinase domain + VfLOV domain (bmpr1aa Vaucheria frigida, Zebrafish)
Available SinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
Aga2p-LOV-Turbo1-myc_pCTCON2
Plasmid#199673Purposeexpresses pre-evolved version of LOV-Turbo on the yeast surfaceDepositorInsertLOV-Turbo1
TagsAga2p and MycExpressionYeastAvailable SinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
LLP792_L2_FRT-OCS-tGFP_Red_mCherry_HSP-FlpO
Plasmid#192382PurposeTo test if a single plasmid stably transformed into Arabidopsis can switched from off to on when heat shocked.DepositorInsertAct2::B3RT-OCS-B3RT::Act2::FRT-OCS-FRT::Turbo GFP
UseSynthetic BiologyTagsN7ExpressionPlantAvailable SinceDec. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP793_L2_V05_s35S_AND_GFP_pOp6_Flp_CO2_B3
Plasmid#192397PurposeTo test if a single plasmid stably transformed into Arabidopsis can switched from off to on when its AND gate unit is activated by both cell type (cortex) and chemical induction (by DEX).DepositorInsert35S::FRT-OCS-FRT::B3RT-OCS-B3RT::Turbo GFP
UseSynthetic BiologyTagsN7ExpressionPlantAvailable SinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
empty-mCh-SspB (pBS1140)
Plasmid#185323PurposeThe empty vector used for the iLID-SspB experiments in our paperDepositorTypeEmpty backboneExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pB80-SSPB(micro)-mVenus-ppKin14VIb(861-1321)
Plasmid#174641PurposeOptogenetic coupling to dimeric moss kinesin-14 for retrograde transport via SSPB(micro)DepositorInsertSSPB(micro)-mVenus-ppKin14VIb(861-1321)
TagsSSPB(micro)-VenusExpressionMammalianMutationSSPB:Arg73Gln; mVenus: Met1Del, Thr154Met; ppKin1…PromoterChicken beta-actinAvailable SinceMarch 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEM-HE-bPAC(R278A)-Myc-eYFP
Plasmid#165488PurposeXenopus oocyte expression of soluble photoactivatable adenylyl cyclase derived from bPAC with reduced dark activityDepositorInsertbPAC(R278A)-Myc-eYFP
UseCdna expression, xenopus oocyteTagsEYFP and MycExpressionBacterialPromoterT7Available SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC57-attB2-SA(1)-CRY2-mCherry
Plasmid#160440PurposeTo create Cry2-mCherry lines from MiMIC lines with inserts into coding introns in Phase 1.DepositorAvailable SinceOct. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUC57-attB2-SA(0)-CRY2-mCherry
Plasmid#160439PurposeTo create Cry2-mCherry lines from MiMIC lines with inserts into coding introns in Phase 0.DepositorAvailable SinceOct. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-CBX1mut-Dronpa
Plasmid#138250PurposeTriple-mutant CBX1 chromodomain (residues 20-73) tagged with reversibly switchable FP Dronpa. Mutations V3E/K6E/D40S correspond to positions V22/K25/D59 in full-length CBX1.DepositorInsertCBX1mut-Dronpa
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianPromoterCMVAvailable SinceJuly 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSR11
Plasmid#69154Purposeread-outloxP mCherry to GFP switch, with fzr-1 promoter, gene and UTR, for integration on cxtTi10816, Mos Chr IVDepositorInsertsUseCre/Lox; MossciExpressionWormMutationcodon-optimzed index 1.0Promoterfzr-1 and rps-27Available SinceFeb. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
MYR-FR-C2D-EGFR
Plasmid#179262PurposeLight-induced clustering of EGFR cytosolic domainsDepositorInsertEGFR (EGFR Human)
UseLentiviralTagsCry2 PHR, FUS, FusionRed, and Myristoylation sequ…PromoterSFFVAvailable SinceFeb. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-CMV-LoxP-DsRed-LoxP-eGFP
Plasmid#65726PurposeFunctions as a genetic Cre reporter that switches from DsRed expression to eGFP expression upon presence of Cre recombinase.DepositorInsertLoxP-DsRed-LoxP-eGFP
UseCre/Lox and LentiviralExpressionMammalianPromoterCMVAvailable SinceJuly 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
Cry2 mCherry RGS4(del 1-33) in pcDNA3.1
Plasmid#64207PurposemCherry fused between Cry2 and RGS4(del 1-33) to study cell migrationDepositorTagsmcherryExpressionMammalianPromoterCMVAvailable SinceMay 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-FLEX-TeLC-P2A-dTomato
Plasmid#159102PurposeCre-dependent tetanus toxin light chain construct with nuclear-localized dTomato fluorophore for conditional silencing of neurons.DepositorInsertTeLC-P2A-NLS-dTomato
UseAAVPromoterhSynapsinAvailable SinceNov. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-anti-GFP(LaG17) PAGER(TF)
Plasmid#229997PurposeExpresses anti-GFP PAGER(TF) (high reversibility) in mammalian cells; used with NanoLuc-Arrestin-TEVp (Addgene #125228) and UAS-Firefly Luciferase reporter (Addgene #104840)DepositorInsertIL2SP-Aro6-LaG17-TEVcs-ALFA-KORD(RAA)-LOV-TEVcs-Gal4
UseAAVExpressionMammalianMutationV360A/R361A on KORDPromoterCMVAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only