We narrowed to 10,658 results for: Uty
-
Plasmid#51435PurposeThis plasmid is a luciferase-based reporter construct to measure the activity of the ApoE promoter fused to ME.1 enhancerDepositorUseLuciferaseExpressionMammalianMutationME.1 enhancer is fused upstream of ApoE promoter …Available SinceFeb. 27, 2014AvailabilityAcademic Institutions and Nonprofits only
-
pDONR207 SARS-CoV-2 NSP1 Delta RC
Plasmid#164522PurposeGateway-compatible Entry vector, with insert of mutated NSP1 CDS from SARS-CoV-2 isolate Wuhan-Hu-1 (amino acid substitutions K164A/H165A)DepositorInsertNSP1 Delta RC (ORF1ab )
ExpressionMammalianMutationInsert of NSP1 gene's CDS from SARS-CoV-2 is…Available SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBK2045-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9-KRAB-MECP2(CMV-gRNA1)
Plasmid#223165Purpose2nd gen. vector for expression of KRAB and truncated MECP2 with dSaCas9 and gRNA1 targeting CMVDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pmiRFP-Vimentin-17-C
Plasmid#108414PurposeVimentin fused to monomeric near-infrared fluorescent protein miRFPDepositorAvailable SinceApril 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-Archon1-KGC-EGFP-ER2
Plasmid#108419PurposeAAV production plasmid encoding for Archon1 fluorescent voltage reporterDepositorInsertArchon1-KGC-EGFP-ER2
UseAAVExpressionMammalianPromoterCaMKIIAvailable SinceApril 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pOPINO_H3
Plasmid#171927PurposeBacterial expression of nanobody VHH_H3, which binds to receptor binding domain of the spike protein of SARS-CoV-2DepositorInsertVHH_H3
TagsHis6ExpressionBacterial and MammalianAvailable SinceSept. 23, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSt1374m-EF1alpha-N-NLS-DNMT3L-L-DNMT3A-L-dcas9-NLS
Plasmid#112214PurposeTargeted DNA methylationDepositorUseCRISPRTagsmCherryMutationD10A,H840A,N863AAvailable SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pOPINO_C5
Plasmid#171925PurposeBacterial expression of nanobody VHH_C5, which binds to receptor binding domain of the spike protein of SARS-CoV-2DepositorInsertVHH_C5
TagsHis6ExpressionBacterialAvailable SinceSept. 23, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Empty)-PGKGFP2ABFP-W
Plasmid#67983PurposeCas9 activity reporter (control) with GFP and BFPDepositorInsertU6gRNA cassette, PGKGFP2ABFP cassette, WPRE
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
px335 Mettl14 sgRNA #2
Plasmid#61514Purposeencodes sgRNA sequence for targeting mouse Mettl14 locus (Cas9-Nickase strategy)DepositorInsertgccgctcccggatctcctgc
UseCRISPRExpressionMammalianAvailable SinceJan. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pOPINO_C1
Plasmid#171924PurposeBacterial expression of nanobody VHH_C1, which binds to receptor binding domain of the spike protein of SARS-CoV-2DepositorInsertVHH_C1
TagsHis6ExpressionBacterialAvailable SinceSept. 23, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCMV-T7-NLS(SV40)-(Spyo_Cas9)-6xHis-NLS(SV40)
Plasmid#185706PurposeCMV and T7 promoter expression plasmid for human codon usage anCas(Spyo_Cas9) with an N-terminal NLS and C-terminal NLSDepositorInsertCas9
Tags6xHis-NLS and NLSExpressionMammalianMutationoptimized for human codon usagePromoterCMV and T7Available SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
JDW 836 (pCS2-V5-mScarlet-I-hsKRAS4A-WT)
Plasmid#156411PurposepCS2 CMV expression vector driving V5-tagged mScarlet-I-fused human KRAS4ADepositorAvailable SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSt1374-N-NLS-DNMT3L-L-DNMT3Amut-L-dcas9-NLS
Plasmid#112209PurposeTargeted DNA methylationDepositorAvailable SinceOct. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
Exp-pcDNA3.2delCMV(EF1α-tTA/TetO-mCh-Rs1)
Plasmid#26797PurposeHuman 5HT4B receptor with D100A mutation, generating the RASSL Rs1. Construct expresses both mCherry and Rs1 via a P2A ribosomal skip sequence. Expresses tTA under EF1α promoter separately.DepositorInsertsTagsmCherry-P2AExpressionMammalianMutationD100APromoterEF1α and short TetO, miniCMVAvailable SinceFeb. 23, 2011AvailabilityAcademic Institutions and Nonprofits only -
JDW 743 (pDONR221-EYFP-hKRAS4B-WT)
Plasmid#156402PurposeGateway middle entry clone encoding EYFP-fused to human KRAS4B, includes a stop codonDepositorAvailable SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBK2047-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9-KRAB-MECP2(APOE-gRNA2)
Plasmid#223167Purpose2nd gen. vector for expression of KRAB and truncated MECP2 with dSaCas9 and gRNA2 targeting human/mouse APOEDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
PET.SUMO eIF4G1 1-200
Plasmid#158791PurposeBacterial expression vector for the expression of N-terminal 6xHIS-SUMO-tagged codon optimized eIF4G1 amino acids 1-200 isoform lacking the microexon.DepositorInserteIF4G1 (codon optimized)
Tags6xHIS and SUMOExpressionBacterialMutationamino acids 1-200PromoterT7Available SinceAug. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-Archon2-KGC-EGFP-ER2
Plasmid#108421PurposeAAV production plasmid encoding for Archon2 fluorescent voltage reporterDepositorInsertArchon2-KGC-EGFP-ER2
UseAAVExpressionMammalianPromoterCAGAvailable SinceJune 6, 2018AvailabilityAcademic Institutions and Nonprofits only