We narrowed to 10,686 results for: ADA
-
Plasmid#174511PurposeCloning plasmid for creating BcLOV4 optogenetic tool fusions. Expresses [BamHI]-BcLOV4-[EcoRI]-GGGSx2-mCherry-[XhoI]-STOP in a pcDNA3.1 backbone.DepositorInsert[BamHI]-BcLOV4-[EcoRI]-GGGSx2-mCherry-[XhoI]-STOP
TagsmCherryExpressionMammalianPromoterCMVAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT/TO-Ufd1-Strep-HA
Plasmid#113474PurposeExpression of human Ufd1 with C-terminal strep-HA tagDepositorInsertUfd1 (UFD1 Human)
Tags2xstrep-HAExpressionMammalianMutationwildtype without stop codonPromoterCMVAvailable SinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-CETN2
Plasmid#227292PurposeDonor template for mStayGold insertion into the N-terminus of the CETN2 locus. For centriole visualization. To be co-transfected with sgRNA plasmid px330-CETN2 (Addgene #227291)DepositorInsertCETN2 Homology Arms flanking a mStayGold Tag (CETN2 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHR-SFFV- MOG-VHVL-M26-synNotch-Gal4VP64
Plasmid#247467PurposeExpresses a synNotch binding to myelin oligodendrocyte glycoproteinDepositorInsertsynNotch receptor using a scFvs binding MOG
UseLentiviralExpressionMammalianAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-VIM
Plasmid#227302PurposeDonor template for mStayGold insertion into the C-terminus of the VIM locus. For intermediate filament visualization. To be co-transfected with sgRNA plasmid px330-PITCh-VIM (Addgene #227301)DepositorInsertVIM Homology Arms flanking a mStayGold Tag (VIM Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 FLAG FBXO31
Plasmid#236429Purposetransient overexpression of FBXO31 in mammalian cellsDepositorAvailable SinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
SECURE miniABEmax-K20A/R21A (pJUL1774)
Plasmid#131312PurposeCMV promoter expression plasmid for bpNLS-TadA7.10(K20A/R21A)-32AA linker-hSpCas9n(D10A)-bpNLS-P2A-EGFP-NLS (miniABEmax with K20A/R21A mutations).DepositorInsertbpNLS-TadA7.10(K20A/R21A)-32AA linker-hSpCas9n(D10A)-bpNLS-P2A-EGFP-NLS
ExpressionMammalianPromoterCMVAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
LLPS1-iLID::EGFP::FTH1 (pBS1042)
Plasmid#185289PurposeFor the mammalian expression of the synthetic protein iLID::eGFP::FTH1 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertiLID::eGFP::FTH1
ExpressionMammalianAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
H11-mScarletSIIN
Plasmid#172438PurposeHipp11 targeting vector, expresses mScarlet-SIINFEKLDepositorInsertmScarlet-SIIN
UseMouse TargetingAvailable SinceJune 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_CCK1.0
Plasmid#208673PurposeExpresses the genetically-encoded fluorescent cholecystokinin (CCK) sensor GRAB_CCK1.0 in neuronsDepositorInsertGPCR activation based cholecystokinin (CCK) sensor GRAB_CCK1.0
UseAAVPromoterhSynAvailable SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
W118-1_hZBTB7B
Plasmid#180380Purposelentiviral transduction of human ZBTB7B geneDepositorAvailable SinceMarch 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
Integrin beta5-2XEGFP
Plasmid#139779PurposeDetecting Integrin beta5 by fluorescence microscopyDepositorAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGFP-mTet1s pc3901
Plasmid#201700PurposeExpresses of GFP-tagged mTet1s in mammalian cellsDepositorAvailable SinceJuly 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
p2R3a-Tq2CFP-OcsT
Plasmid#71268PurposeEntry clone containing Turqoise2. Can be fused with linker to the C-terminal end of protein of interest. For use in plants and compatible with the MultiSite Gateway systemDepositorInsertTq2CFP
UseGatewayTags4xGly linker and octaline synthase terminatorAvailable SinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a_CRATES
Plasmid#176251PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and type IIS restriction site for endonuclease BaeI at the crRNA region that facilitates the generation of mulitplDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-CANX
Plasmid#227280PurposeDonor template for mStayGold insertion into the C-terminus of the CANX locus. For ER visualization. To be co-transfected with sgRNA plasmid px330-CANX (Addgene #227279)DepositorInsertCANX Homology Arms flanking a mStayGold Tag (CANX Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
mRFP-PA-GFP-RhoAQ63L
Plasmid#187282PurposeExpress pmRFP-PAGFP-RhoA Q63LDepositorAvailable SinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsNot7-D40AE42A_L
Plasmid#146890PurposeMammalian Expression of HsNot7-D40AE42A. Please note that this plasmid does not contain the T7 promoter.DepositorInsertHsNot7-D40AE42A (CNOT7 Human)
ExpressionMammalianAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEN244 - CTCF-AID[71-114]-eGFP-FRT-Blast-FRT targeting construct
Plasmid#92140PurposeTargeting vector to introduce an AID-eGFP cassette at the mouse CTCF locus using BLASTICIDIN selection. Auxin-inducible degron system.DepositorInsertAID[71-114]-eGFP
UseMouse TargetingExpressionMammalianAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only