We narrowed to 5,041 results for: U6...
-
Plasmid#117140PurposeExpress gRNA vs Dmap1DepositorInsertgDmap1 v1 (Dmap1 Synthetic)
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6(gDmap1 v2)-PGK-Puro-BFP
Plasmid#117141PurposeExpress gRNA vs Dmap1DepositorInsertgDmap1 v2 (Dmap1 Synthetic)
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-Diras2_2-hSyn::mCherry.3xFLAG-WPRE
Plasmid#120394PurposepAAV plasmid expressing Diras2 shRNA2 under the U6 promoter and mCherry.3XFLAG under the hSyn promoterDepositorAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pT2K-CAGGS-U6-sgRNA-M7-IRES-CFP
Plasmid#114730PurposesgRNA targeting a sequence upstream of the initiator ATG of the cellular Myc geneDepositorInsertsgRNA M7
UseCRISPRExpressionMammalianAvailable SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pT2K-CAGGS-U6-sgRNA-M5-IRES-CFP
Plasmid#114728PurposesgRNA targeting a sequence upstream of the initiator ATG of the cellular Myc geneDepositorInsertsgRNA M5
UseCRISPRExpressionMammalianAvailable SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR U6 n.s shRNA L1-L4
Plasmid#62136PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a U6 promoter and a non-silencing (scrambled) shRNA module. Compatible with MultiSite Gateway cloningDepositorInsertnon-silencing (scrambled) shRNA
UseRNAi; Mule gateway entry vectorExpressionMammalianPromoterU6Available SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR U6 n.s shRNA R4-R3
Plasmid#62137PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a U6 promoter and a non-silencing (scrambled) shRNA module. Compatible with MultiSite Gateway cloningDepositorInsertnon-silencing (scrambled) shRNA
UseRNAi; Mule gateway entry vectorExpressionMammalianPromoterU6Available SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR U6 n.s shRNA L5-L2
Plasmid#62139PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a U6 promoter and a non-silencing (scrambled) shRNA module. Compatible with MultiSite Gateway cloningDepositorInsertnon-silencing (scrambled) shRNA
UseRNAi; Mule gateway entry vectorExpressionMammalianPromoterU6Available SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pF(UG) U6-SYT7 sgRNA 777 HaloTag
Plasmid#179724PurposeU6-driven SYT7 gRNA and HaloTag lentiviral vector for CRISPR/HITIDepositorInsertsgRNA and HaloTag
UseLentiviralAvailabilityAcademic Institutions and Nonprofits only -
Multiple Lentiviral Expression (MuLE) system
Plasmid Kit#1000000060PurposeMultiple Lentiviral Expression (MuLE): modular system used to construct complex lentiviruses for modification of mammalian cells with a single viral infection.DepositorAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
U6-sgRNA(HEK3)-CMV-SpCas9(D10A)-P2A-EGFP
Plasmid#221233PurposeExpress sgRNA targeting HEK3 loci with nCas9(D10A)DepositorInsertSpCas9(D10A)-P2A-EGFP
ExpressionMammalianAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-EF1aCore-SaCas9-dual(U6-sgRNA(backbone))-ITR
Plasmid#207878PurposeAAV vector encoding EF1a core promoter-driven SaCas9 and two sgRNA cloning sites w/ the engineered Sa Guide scaffold variant (BbsI and PaqCI for sgRNA cloning).DepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianAvailable SinceOct. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-EF1aCore-SaCas9-single(U6-sgRNA(backbone))-ITR
Plasmid#207880PurposeAAV vector encoding EF1a core promoter-driven SaCas9 and single sgRNA cloning site w/ the engineered Sa Guide scaffold variant (BbsI for sgRNA cloning).DepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianAvailable SinceNov. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-AsCpf1-2A-GFP-U6-sgRNA-cloning vector
Plasmid#159281PurposeA multicistronic vector with both CAGGS promoter-driven AsCpf1 and U6 promoter-driven single guide RNA (sgRNA)DepositorInsertAsCpf1-HA-2A-GFP
UseMulticistronic vector with both caggs promoter-dr…Tags3X HAExpressionMammalianPromoterU6Available SinceSept. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAV-U6+27-Tornado-F30-Broccoli-aptNFkB#5
Plasmid#124362PurposeOverexpression of bifunctional circular RNA (Broccoli fluorescence and NFkB binding)DepositorInsertTornado-F30-Broccoli-aptNFkB#5
ExpressionMammalianPromoterU6+27Available SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
(559) pAAV EF-1a KRAB-SadCas9 U6-gRNA
Plasmid#163024PurposeExpression of CRISPRi with U6-gRNA (Bsa1 sites)DepositorInsertMammalian codon-optimized SadCas9
UseAAVTagsKRAB, SV40 polyA, and myc NLSExpressionMammalianPromoterhEF-1aAvailable SinceJan. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
Pzac2.1 U6-control sgRNA1, 2, 3_gfaABC1D mcherry SV40
Plasmid#179120PurposeExpresses control sgRNAs under the U6 promoter and mcherry protein specifically in astrocytesDepositorInsertcontrol sgRNA
UseAAVPromoterU6Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-Agrp-(mouse)-MS2gRNA-hSyn-MCP-MSN
Plasmid#210709PurposeThis Plasmid express U6 promoter driven SpdCas9 specific gRNA and hSyn promoter driven MCP-MSN transactivation moduleDepositorInsertSpdCas9 specific Agrp (mouse) MS2gRNA and MCP-MSN
UseAAV and CRISPRExpressionMammalianMutationN55K in MCPPromoterU6Available SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only