We narrowed to 23,817 results for: c-myc
-
Plasmid#8920DepositorAvailable SinceAug. 19, 2005AvailabilityAcademic Institutions and Nonprofits only
-
ABL1-HaloTag Fusion Vector
Plasmid#238634PurposeExpress ABL1-HaloTag Fusion Protein in Mammalian Cells under a CMV promoterDepositorHas ServiceDNAInsertABL1 (ABL1 Human)
TagsHaloTag (R)ExpressionMammalianMutationNonePromoterCMVAvailable SinceSept. 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
HaloTag-ABL1 Fusion Vector
Plasmid#238635PurposeExpress HaloTag-ABL1 Fusion Protein in Mammalian Cells under a CMV promoterDepositorHas ServiceDNAInsertABL1 (ABL1 Human)
TagsHaloTag (R)ExpressionMammalianMutationNonePromoterCMVAvailable SinceSept. 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAM211 His-Ubp6
Plasmid#226359PurposeExpression of yeast Ubp6DepositorAvailable SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-L1374
Plasmid#226275PurposePlasmid expressing the SEC18 allele from L-1374, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-S288C
Plasmid#226274PurposePlasmid expressing the SEC18 allele from S288C, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-NCYC110
Plasmid#226277PurposePlasmid expressing the SEC18 allele from NCYC110, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-UWOPS872421
Plasmid#226276PurposePlasmid expressing the SEC18 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-S288C
Plasmid#226266PurposePlasmid expressing the SCT1 allele from S288C, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-L1374
Plasmid#226267PurposePlasmid expressing the SCT1 allele from L-1374, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-LUG1
Plasmid#226265PurposePlasmid expressing Cas9 and gRNA TCTTCAAGTTACTCCAAGAG which targets the LUG1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#226263PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-NCYC110
Plasmid#226269PurposePlasmid expressing the SCT1 allele from NCYC110, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-UWOPS872421
Plasmid#226268PurposePlasmid expressing the SCT1 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
TaraACR1-pmCherry-C1
Plasmid#204960PurposeExpression of TaraACR1 in fusion with mCherry in mammalian cellsDepositorInsertTaraACR1
TagsmCherryExpressionMammalianPromoterCMV (+ enhancer)Available SinceOct. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
TaraACR2-pmCherry-C1
Plasmid#204961PurposeExpression of TaraACR2 in fusion with mCherry in mammalian cellsDepositorInsertTaraACR2
TagsmCherryExpressionMammalianPromoterCMV (+ enhancer)Available SinceOct. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
TaraACR3-pmCherry-C1
Plasmid#204962PurposeExpression of TaraACR3 in fusion with mCherry in mammalian cellsDepositorInsertTaraACR3
TagsmCherryExpressionMammalianPromoterCMV (+ enhancer)Available SinceOct. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL0_15 [CEN6/ARSH4 ORI]
Plasmid#198928PurposeLevel 0 partDepositorInsertCEN6/ARSH4 ORI
UseSynthetic BiologyAvailable SinceJuly 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
GB3682
Plasmid#187807PurposeTranscriptional unit for expression of alcohol O-acetyltransferase from Saccharomyces pastorianus strain CBS 1483 chromosome SeVIII-SeXV, codon optimized for Nicotiana.DepositorInsertSpATF1-2
ExpressionPlantAvailable SinceJune 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
LDB221
Plasmid#185427PurposeBacterial expression of Nup1 C-terminal residues 777-1076 as GST fusionDepositorInsertNUP1
TagsGSTExpressionBacterialMutationNup1 C-terminal residues 777-1076Available SinceJuly 25, 2022AvailabilityAcademic Institutions and Nonprofits only