We narrowed to 41,273 results for: LAT

#169628

Tier-2 co-expression vector encoding PhCMV-driven SEAP coupled to fluorescent reporter iRFP670 and PmPGK1-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 that is insulated via a 5' insulator sequence derived from the pGL3 plasmid (PhCMV-SEAP-p2A-iRFP670-pA::pGL3-PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA::A3-pA).

Martin Fussenegger

Haellman et al Metab Eng. 2021 Jul;66:41-50. doi: 10.10

Sept. 19, 2022

Academic Institutions and Nonprofits only

#169626

Tier-2 co-expression vector encoding PhCMV-driven SEAP coupled to fluorescent reporter iRFP670 and PmPGK1-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 that is insulated via a 5' CoTC insulator sequence (PhCMV-SEAP-p2A-iRFP670-pA::CoTC-PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA::A3-pA).

Martin Fussenegger

Haellman et al Metab Eng. 2021 Jul;66:41-50. doi: 10.10

Sept. 19, 2022

Academic Institutions and Nonprofits only

#169627

Tier-2 co-expression vector encoding PhCMV-driven SEAP coupled to fluorescent reporter iRFP670 and PmPGK1-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 that is insulated via a 5' Tactb insulator sequence (PhCMV-SEAP-p2A-iRFP670-pA::Tactb-PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA::A3-pA).

Martin Fussenegger

Haellman et al Metab Eng. 2021 Jul;66:41-50. doi: 10.10

June 28, 2022

Academic Institutions and Nonprofits only

#169622

Tier-2 co-expression vector encoding PhCMV-driven SEAP coupled to fluorescent reporter iRFP670 and PmPGK1-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 that is insulated via a 5' CoTC insulator sequence (PhCMV-SEAP-p2A-iRFP670-pA::A2-pA::CoTC-PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA).

Martin Fussenegger

Haellman et al Metab Eng. 2021 Jul;66:41-50. doi: 10.10

June 28, 2022

Academic Institutions and Nonprofits only

#169624

Tier-2 co-expression vector encoding PhCMV-driven SEAP coupled to fluorescent reporter iRFP670 and PmPGK1-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 that is insulated via a 5' insulator sequence derived from the pGL3 plasmid (PhCMV-SEAP-p2A-iRFP670-pA::A2-pA::pGL3-PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA).

Martin Fussenegger

Haellman et al Metab Eng. 2021 Jul;66:41-50. doi: 10.10

June 28, 2022

Academic Institutions and Nonprofits only

#184876

Donor template for knock-in of p2a-CreERT2 into the medaka col2a1a locus via CRISPR/Cas9-mediated homology directed repair

Christoph Winkler

Hui et al Development. 2022 May 20. pii: 275483. d

June 7, 2022

Academic Institutions and Nonprofits only

#167173

Expresses the full Leptodactylus latrans Na+K+ATPase with ATP1A1-S variant with Q111R mutation in Sf9 cells

Susanne Dobler

Mohammadi et al Curr Biol. 2021 Jun 21;31(12):2530-2538.

Feb. 7, 2022

Academic Institutions and Nonprofits only

#167174

Expresses the full Leptodactylus latrans Na+K+ATPase with ATP1A1-S variant with N122D mutation in Sf9 cells

Susanne Dobler

Mohammadi et al Curr Biol. 2021 Jun 21;31(12):2530-2538.

Feb. 7, 2022

Academic Institutions and Nonprofits only

#177846

Bacterial Expression of SnRK2.3

Karsten Melcher

Ng et al Proc Natl Acad Sci U S A. 2011 Dec 27;10

Dec. 10, 2021

Academic Institutions and Nonprofits only

#165615

Vector for expression of SpCas9 in yeast after assembly with PID fragments: TEF1p-SpCas9::KanR-1xNLS-CYC1t (KanR cassette in place of the PID)

Marcus Noyes

Goldberg et al Nat Commun. 2021 Jan 13;12(1):349. doi:

April 21, 2021

Academic Institutions and Nonprofits only

#158744

Expresses K2P4.1 isoform B with TEV protease cleavable N- and C-terminal affinity tags.

Arthur Laganowsky

Schrecke et al Nat Chem Biol. 2021 Jan;17(1):89-95. doi

Sept. 29, 2020

Academic Institutions and Nonprofits only

#113011

For bacterial expression of MBP fusion of full-length Drosophila Tral with phosphomutations (15A)

Terry Orr-Weaver

Hara et al Elife. 2018 Feb 26;7. pii: 33150. doi: 1

Aug. 2, 2018

Academic Institutions and Nonprofits only

#113007

For bacterial expression of MBP fusion of C terminal region of Drosophila Tral phosphomutant (15A)

Terry Orr-Weaver

Hara et al Elife. 2018 Feb 26;7. pii: 33150. doi: 1

Aug. 2, 2018

Academic Institutions and Nonprofits only

#85210

TRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.

Sandra Martha Gomes Dias

Quintero et al BMC Cancer. 2017 Nov 7;17(1):727. doi: 1

Oct. 4, 2017

Academic Institutions and Nonprofits only

#100746

Bacterial expression of GST-tagged beta2 subunit of AP2 complex (hinge and ear) long splice form, mutant

Stephen Royle

Wood et al J Cell Biol. 2017 Sep 27. pii: jcb.20170

Sept. 29, 2017

Academic Institutions and Nonprofits only

#100745

Bacterial expression of GST-tagged beta2 subunit of AP2 complex (hinge and ear) long splice form, mutant

Stephen Royle

Wood et al J Cell Biol. 2017 Sep 27. pii: jcb.20170

Sept. 12, 2017

Academic Institutions and Nonprofits only

#89744

Expression of light-regulated JNK inhibitor, firefly luciferase-fused, wild-type photosensor, inhibitor JIP11

Michael Courtney

Melero-Fernandez de Mera et al Nat Commun. 2017 May 12;8:15017. doi: 10

Aug. 29, 2017

Academic Institutions and Nonprofits only

#53969

842 bp insert from mouse Ins2 gene used as a control for methylation-specific PCR assays

Kevin Ferreri

Husseiny et al PLoS One. 2012;7(10):e47942. doi: 10.137

July 25, 2014

Academic Institutions and Nonprofits only