We narrowed to 9,772 results for: Tec;
-
Plasmid#167169PurposeExpresses rat APOBEC1 L173A/G227A in mammalian cells. Please note that this does not express GFP.DepositorArticleInsertAPOBEC1 (Apobec1 Rat)
ExpressionMammalianMutationchanged Leucine 173 to Alanine; changed Glycine 2…PromoterCMV promoterAvailable SinceMay 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
mRFP-FKBP-INPP5E(D556A)
Plasmid#183678PurposeRecruitable human type IV 5-phosphatase enzyme (catalytically inactive)DepositorInsertINPP5E (INPP5E Human)
TagsmRFP-FKBP12(1-108)ExpressionMammalianMutationC641A, D556APromoterCMVAvailable SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
Flag-hPKL S113D
Plasmid#107161PurposeFor mammalian expression of Flag-hPKL S113DDepositorInsertFlag-hPKL S113D (PKLR Human)
UseRetroviralTagsN-term FlagExpressionMammalianMutationSerine 113 mutated to aspartatePromoterCMVAvailable SinceDec. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
Flag-hPKL S113A
Plasmid#107160PurposeFor mammalian expression of Flag-hPKL S113ADepositorInsertFlag-hPKL S113A (PKLR Human)
UseRetroviralTagsN-term FlagExpressionMammalianMutationSerine 113 mutated to alaninePromoterCMVAvailable SinceDec. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFRT-TODestFLAGHA_RBPMS2_HindIII
Plasmid#65666PurposeFLAG-HA expression vector with RBPMS2 carrying mutation to introduce HindIII siteDepositorInsertRBPMS2 (RBPMS2 Human)
TagsFLAG HAExpressionMammalianMutationintroduced HindIII site (final goal to exchange F…PromoterCMV, 2x TetAvailable SinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-Flag-Med25-VWA
Plasmid#64772PurposeMammalian expression of Flag-tagged Med25-VWADepositorAvailable SinceJune 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
GFP-DroshaS302D
Plasmid#62529PurposeSerine 302 of Drosha is mutated to aspartic acidDepositorInserthuman Drosha with serine 302 changed to aspartic acid (DROSHA Human)
TagsGFPExpressionMammalianMutationchanged serine 302 to aspartic acidAvailable SinceMarch 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
GFP-DroshaS300E
Plasmid#62528PurposeSerine 300 of Drosha is mutated to glutamic acidDepositorInserthuman Drosha with serine 300 changed to glutamic acid (DROSHA Human)
TagsGFPExpressionMammalianMutationchanged serine 300 to glutamic acidAvailable SinceMarch 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRS416-PHO5-GFP-2xOsh2 PH domain EE mutation
Plasmid#58830PurposeExpresses GFP-Tagged and mutated Osh2 PH domain in yeastDepositorInsert2 x Osh2 PH domain (OSH2 Budding Yeast)
TagsGFP and MycExpressionYeastMutationchanged Lysine 307 to Glutamate and Arginine 309 …PromoterPHO5Available SinceSept. 30, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1 Slp2-a C2A
Plasmid#40052DepositorInsertSlp2-a C2A (Sytl2 Mouse)
TagsEGFPExpressionMammalianMutationC2A domainsPromoterCMV promoterAvailable SinceNov. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pIRES2-eGFP-Ofd1-Myc-G139S
Plasmid#24581DepositorInsertOfd1 (Ofd1 Mouse)
TagsMyc and eGFPExpressionMammalianMutationGlycine 139 changed to serine (codon GGT to AGT)Available SinceJune 7, 2010AvailabilityAcademic Institutions and Nonprofits only -
pIRES2-eGFP-Ofd1-Myc-S437R
Plasmid#24582DepositorInsertOfd1 (Ofd1 Mouse)
TagsMyc and eGFPExpressionMammalianMutationSerine 437 changed to Arginine (codon AGT to CGT)Available SinceJune 7, 2010AvailabilityAcademic Institutions and Nonprofits only -
hSyn-HA-PGRN-LAMP1TM-IRES-GFP
Plasmid#234877PurposeLentiviral plasmid expressing HA-tagged human progranulin that is fused to the transmembrane domain and cytosolic tail of LAMP-1. Enables lysosomal delivery of progranulin without secretion.DepositorInsertProgranulin (GRN Human)
UseLentiviralTagsHA tag and LAMP-1 transmembrane domain and cytoso…ExpressionMammalianPromoterhSYnAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTon1(il11)
Plasmid#233647PurposeExpression vector of X. laevis il11.L-P2A-AcGFP1 under control of tetracycline responsive element (TRE). Also express Tet-on advenced transactivator (rtTA) under control of minimal CMV promoter.DepositorInsertsinterleukin-11.L (350-913) (il11.L Frog)
target sequence of guide RNA #tyr (3905-3927) 5'-GGCTCCATGTCTTCCGTCCAAGG-3'
UseAmphibian expression, tet-onMutationSome synonymous substitutions were introduced in…Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
Epac-S-H332
Plasmid#228250PurposemT2Del_EPACdDEPCD_L777A_K778A_tdBlackcp173Venus(ST) biosensor to measure realtime changes in FRET reflecting fluctuations in cAMP levels in living cells.DepositorInsertmT2Del_EPACdDEPCD_L777A_K778A_tdBlackcp173Venus(ST) (RAPGEF3 Human)
ExpressionMammalianMutationDeletion of DEP domain, Catalytically dead T781A …PromoterCMVAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR-GAL4-UAS—sTNFaR-IRES-mCherry-PGK-BFP
Plasmid#223214PurposeLentiviral vector - mCherry reporter and sTNFaR for Gal4DBDVP64 synNotch receptors with a constitutive BFPDepositorAvailable SinceDec. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-Sec22b-P33-shR
Plasmid#208359PurposeMammalian expression of fluorescent N-terminally tagged shRNA resistant Sec22b-P33 mutantDepositorInsertSec22b (Sec22b Rat)
TagsEGFPExpressionMammalianMutationfour silent mutations (shRNA resistance), 33 aa p…PromoterCMVAvailable SinceApril 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
M2e-noro-VLP
Plasmid#201192PurposeExpresses noro-VLP decorated with influenza M2e in insect cellsDepositorInsertM2e-noro-VLP
TagsInfluenza M2e peptideExpressionInsectPromoterPolyhedrinAvailable SinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
CRY2clust-mCherry-RANK-P2A-CIBNcaax
Plasmid#208613PurposeMammalian expression of CRY2clust-mCherry-RANK-P2A-CIBNcaax (Opto-RANKm)DepositorInsertCRY2clust-mCherry-RANK-P2A-CIBNcaax (Cry2 Mouse, Mustard Weed)
TagsCAAX and mCherryExpressionMammalianPromoterCAGAvailable SinceJan. 22, 2024AvailabilityAcademic Institutions and Nonprofits only