We narrowed to 21,829 results for: SPR
-
Plasmid#180014PurposeTargeting vector for knocking in constitutively expressed PE2-2A-GFP into the human AAVS1 locusDepositorInsertPE2-2A-GFP
UseCRISPR; Human genome engineeringTagsGFPPromoterCAGAvailable SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
p23-NES-PspCas13b-msfGFP-NES-Flag
Plasmid#165071Purposeoverexpression of PspCas13b in human cellsDepositorInsertPspCas13b
UseLentiviralExpressionMammalianAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
ND4 left TALE–G1333 DddAtox C
Plasmid#158092Purposeexpresses the right-side ND4 TALE–DddAtox half in mammalian cellsDepositorInsertSOD2 MTS–3xHA–ND4 left TALE–G1333 DddAtox-C–1xUGI
ExpressionMammalianMutationWTAvailable SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUF-AsCpf1-pre-gRNA
Plasmid#137849PurposeAsCpf1 and gRNA expression plasmid for P. falciparum with yDHODH selectable marker.DepositorInsertAsCpf1 and pre-gRNA cassette
UseCRISPRAvailable SinceApril 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_EIF2AK2
Plasmid#106108PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting EIF2AK2DepositorInsertgRNA targeting EIF2AK2 (EIF2AK2 Human)
UseCRISPRAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTMt_NES_TCS(Q’G)_HA-dCas9(N)_P2A-Puro-WPRE
Plasmid#101101PurposeEncodes dCas9(N) fused to transmembrane tetherDepositorInsertTMt-dCas9(N)
UseCRISPR and Synthetic BiologyTagsHA and MycExpressionMammalianAvailable SinceNov. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-PIG-miR-146a
Plasmid#64234PurposeExpresses miR-146a in mammalian cellsDepositorAvailable SinceNov. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
psgRNA (GB0645)
Plasmid#68210PurposeProvides a Short guide RNA which is the combination of the bacterial crRNA and tracrRNA into a single guide transcript; it does not contain any target siteDepositorInsertSgRNA
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceOct. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT22
Plasmid#223394PurposeT-DNA vector for A3A/Y130F-CBE_V01 based C-to-T base editing for monocot plants; NG or NA PAM ; wide working window; A3A/Y130F-CBE_V01 was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter.DepositorInsertZmUbi-hA3A-Y130F-SpRYD10A-UGI-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT39
Plasmid#223411PurposeT-DNA vector for SpRY-D10A based A-to-G base editing for dicot plants; NA or NG PAM preference; SpRYD10A-ABE was driven by 2x35s and the sgRNA was driven by AtU3 promoter; Kanamycin for plants select.DepositorInsert2x35s-ecTadA8e-SpRY-D10A-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT19
Plasmid#223391PurposeT-DNA vector for A3A/Y130F-CBE_V01 based C-to-T base editing for dicot plants; NG or NA PAM ; wide working window; A3A/Y130F-CBE_V01 was driven by AtUBQ10 and the sgRNA was driven by AtU3 promoter.DepositorInsertAtUBQ10-hA3A-Y130F-SpRYD10A-UGI-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
Perturb-FISH
Plasmid#220626Purposeexpression of gRNAs under U6T7 promoterDepositorInsertsgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterBsmBIAvailable SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pC178: pAAV.U6.SapI.CMV.Cas13bt3
Plasmid#204215PurposePlasmid AAV vector expressing Cas13bt3 and hU6-driven expression of guide RNAs. Contains SapI sites for guide cloning flanked by 5' and 3' full-length DRs.DepositorInsertCas13bt3 and U6.SapI sgRNA cloning site
UseAAV and CRISPRTagsHA and NLSExpressionMammalianMutationCodon optimisation by GenScript toolPromoterCMV/U6Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-GOLGA2
Plasmid#227325PurposeDonor template for mStayGold insertion into the N-terminus of the GOLGA2 locus. For Golgi visualization. To be co-transfected with sgRNA plasmid px330-PITCh-GOLGA2 (Addgene #207791)DepositorInsertGOLGA2 Homology Arms flanking a mStayGold Tag (GOLGA2 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-CETN2
Plasmid#227292PurposeDonor template for mStayGold insertion into the N-terminus of the CETN2 locus. For centriole visualization. To be co-transfected with sgRNA plasmid px330-CETN2 (Addgene #227291)DepositorInsertCETN2 Homology Arms flanking a mStayGold Tag (CETN2 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPBT/EFS-Cas9-PuroTk
Plasmid#170542PurposeExpresses spCas9 with a P2A junction to the puromycin resistance gene directly fused to the thymidine kinaseDepositorInsertPuroTK
UseCRISPRExpressionMammalianAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-eGFP-mPlum-HA
Plasmid#200009PurposeDonor vector with double fluorescence system for targeted integration using CRISPR/Cas9. Expresses 5´HA--eGFP&PuroR--3´HA--mPlum. Distinguish targeted from random integration by fluorescence.DepositorInserteGFP, mPlum
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceJune 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGal-BE3
Plasmid#172409PurposeYeast plasmid encoding the third-generation CRISPR base editor BE3 (Komor et al., Nature 2016) under a galactose-inducible promoterDepositorInsertBE3
UseCRISPRExpressionYeastPromoterGALLAvailable SinceNov. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEasyG1_nat
Plasmid#184911PurposeTemplate to generate via PCR a single gRNA for expression in S. cerevisiaeDepositorInsertgRNA scaffold
UseCRISPRExpressionBacterial and YeastAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only